TkA01G411110 | RubberDandelionOmics

Gene overview

TkA01G411110

Reference: TK1151 Chr: Chr01 Coordinates: 102545210-102548843 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1796 bp · TkA01G411110|TK1151|cDNA

AAAGCTCGTAAGTAGTGGGCTAGTTCTTGGATTTAAAGCTCAAAAAATGGAACATCCTCAGGCTGTTGAGGAACATGAATTAGTTATGGAGCTCTCTGAAAAAGATATGCTCTTTGACAAAAAGAAGAAATTATTACAAGTCAAGGGTTTTGACCCTAATGGAAAAGTCAAAATCACAAGCACCTACACCATAGATTTGGTGAATTCTGTTTTGGAAGAGATGCTTCAGAGAGCTAGAATCATACAAGCAAATGAGATCG...

CDS

Download CDS FASTA

1263 bp · TkA01G411110|TK1151|CDS

ATGTCACCAGAAAAAATGGAACATCCTCAGGCTGTTGAGGAACATGAATTAGTTATGGAGCTCTCTGAAAAAGATATGCTCTTTGACAAAAAGAAGAAATTATTACAAGTCAAGGGTTTTGACCCTAATGGAAAAGTCAAAATCACAAGCACCTACACCATAGATTTGGTGAATTCTGTTTTGGAAGAGATGCTTCAGAGAGCTAGAATCATACAAGCAAATGAGATCGATCTTTACTTTAAAGGAGTTGGATTTTGCAG...

Protein

Download Protein FASTA

420 aa · TkA01G411110|TK1151|PROTEIN

MSPEKMEHPQAVEEHELVMELSEKDMLFDKKKKLLQVKGFDPNGKVKITSTYTIDLVNSVLEEMLQRARIIQANEIDLYFKGVGFCSPRNELESLNSILSVLANKSKSMGEEQTRPKVFQDLTNATLNMIHEFSNNIIDDTKIVASWNLEKEKRLLQWGESNGVKTRVDIAYVEGGGRGGIAREDLEVGDIALEVHISAIISEDLIYETDMFRVLEKVEGISSETMLLLWSMKEKYDTNSKFKLYFDSLPQAFNTGLSFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G411110`
TK1151 ID	TkA01G411110
OH-1004 ID	LXL04_002915
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.100
Protein coverage (%)	TK1151 98.810 / OH-1004 67.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G411110`
Location	Chr01:102545210-102548843 (-)
Description	Similar to RBCMT: Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002915` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006338 chromatin remodeling Biological Process GO:0018021 peptidyl-histidine methylation Biological Process GO:0018023 peptidyl-lysine trimethylation Biological Process GO:0030047 actin modification Biological Process GO:0032259 methylation Biological Process GO:0032760 positive regulation of tumor necrosis factor production Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0070472 regulation of uterine smooth muscle contraction Biological Process GO:0071863 regulation of cell proliferation in bone marrow Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference	ag:AAA69903 ag:AAC49566 ath:AT1G14030 mmu:224440 nta:107778201 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.434

Rank 1 · TkA01G411110 · TK1151

Cytoplasm0.385

Rank 2 · TkA01G411110 · TK1151

Plastid0.206

Rank 3 · TkA01G411110 · TK1151

Cell membrane0.059

Rank 4 · TkA01G411110 · TK1151

Endoplasmic reticulum0.056

Rank 5 · TkA01G411110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00856SET12-51 aa

PF09273Rubis-subs-bind23-155 aa

PF07661MORN_237-52 aa

PF00856SET177-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G411110	`PF00856`	SET	12	51	0.028	15.6
TkA01G411110	`PF09273`	Rubis-subs-bind	23	155	0.0012	20.2
TkA01G411110	`PF07661`	MORN_2	37	52	0.23	12.5
TkA01G411110	`PF00856`	SET	177	384	0.028	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card