LXL04_002915 | RubberDandelionOmics

Gene overview

LXL04_002915

Reference: OH-1004 Chr: Chr01 Coordinates: 61243194-61246898 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1803 bp · LXL04_002915|LXL04_002915|OH1004|cDNA

ATGTCACCAGAAAAAATGGAACATCCTCAGGCTGTTGAGGAACATGAATTAGTTATGGAGCTCTCTGAAAAAGATATGCTCTTTGACAAAAAGAAGAAATTATTACAAGTCAAAGGTTTTGACCCTAATGGAAAAGTCAAAATCACAAGCACCTACACCATAGATTTGGTGAATTCTGTTTTGGAAGAGATGCTTCAGAGAGCTAGAATCATACAAGCAAATGAGATCGATCTTTACTTTAAAGGAGTTGGATTTTGCAG...

CDS

Download CDS FASTA

1803 bp · LXL04_002915|LXL04_002915|OH1004|CDS

ATGTCACCAGAAAAAATGGAACATCCTCAGGCTGTTGAGGAACATGAATTAGTTATGGAGCTCTCTGAAAAAGATATGCTCTTTGACAAAAAGAAGAAATTATTACAAGTCAAAGGTTTTGACCCTAATGGAAAAGTCAAAATCACAAGCACCTACACCATAGATTTGGTGAATTCTGTTTTGGAAGAGATGCTTCAGAGAGCTAGAATCATACAAGCAAATGAGATCGATCTTTACTTTAAAGGAGTTGGATTTTGCAG...

Protein

Download Protein FASTA

600 aa · LXL04_002915|LXL04_002915|OH1004|PROTEIN

MSPEKMEHPQAVEEHELVMELSEKDMLFDKKKKLLQVKGFDPNGKVKITSTYTIDLVNSVLEEMLQRARIIQANEIDLYFKGVGFCSPRNELESLNSILSVLANKSKSMGEEQTRPKVFQDLTNATLNMIHEFSNNIIDDTKIVASWNLEKEKRLLQWGESNDVEGGGRGGIAREDLEVGDIALEVHISAIISEDLIYETDMFRVLEKVEGISSETMLLLWSMKEKYDTNSKFKLYFDSLPQAFNTGLSFGMEAVMALDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002915`
TK1151 ID	TkA01G411110
OH-1004 ID	LXL04_002915
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.100
Protein coverage (%)	TK1151 98.810 / OH-1004 67.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002915

Location Chr01:61243194-61246898 (+)

Description Similar to RBCMT: Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14030`	Protein-lysine methyltransferase methylating chloroplastic fructose 1,6-bisphosphate aldolases.	Characterization of chloroplastic fructose 1,6-bisphosphate aldolases as lysine-methylated proteins in plants.2012 · DOI: 10.1074/jbc.m112.359976

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002915 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0018021 peptidyl-histidine methylation Biological Process

GO:0018023 peptidyl-lysine trimethylation Biological Process

GO:0030047 actin modification Biological Process

GO:0032259 methylation Biological Process

GO:0032760 positive regulation of tumor necrosis factor production Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0070472 regulation of uterine smooth muscle contraction Biological Process

GO:0071863 regulation of cell proliferation in bone marrow Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ag:AAA69903

ag:AAC49566

ath:AT1G14030

mmu:224440

nta:107778201

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.453

Rank 1 · LXL04_002915 · OH-1004

Cytoplasm0.398

Rank 2 · LXL04_002915 · OH-1004

Plastid0.111

Rank 3 · LXL04_002915 · OH-1004

Cell membrane0.072

Rank 4 · LXL04_002915 · OH-1004

Endoplasmic reticulum0.061

Rank 5 · LXL04_002915 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI84`	Arabidopsis thaliana	[Fructose-bisphosphate aldolase]-lysine N-methyltransferase, chloroplastic	24.891%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card