TkA01G407630 | RubberDandelionOmics

Gene overview

TkA01G407630

Reference: TK1151 Chr: Chr01 Coordinates: 101767035-101771769 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3064 bp · TkA01G407630|TK1151|cDNA

AAACCCCAAATCAATTTATATTAATATGGCTGATTTATGAGTTTAATTCAATCAAAGACTCCACCATCTTTGCCCTCTTGTCTGGTCCGTTCCCAAAAGAGTAATGTAGCTCTTTATTTCACTGTTCTTGACTTTCGGAATCAAATCTGTTTGCAATATTTTCATCCATGGTAGATTACTGAAGATGGTGTTACTAGTATTGATTTGATTCTTTTCTTGGATCAATGTTGATCACATGGGTTATCAGATGCAGATGAAAG...

CDS

Download CDS FASTA

2475 bp · TkA01G407630|TK1151|CDS

ATGTTGTATCATTGTAGGAGGTTTCTAACCACCGAAGATATGTTTAGAATTATAATTTTATTGGGTCTTTTGGTTATCGGGAAAGCAGAGATTTATATTGTAACAATTGAAGGACAGCCAGTTATAAGTTACACTGGCGGCGTTAGTGGTTTTAAAGCGACCGCCGTTGAATCCGATGAGACACTTGATGTCACCAGTGAATTGGTTTCATCATACGCCCGCCACCTGGAACTGAAACATGATACTCTTCTTGAAACTTT...

Protein

Download Protein FASTA

824 aa · TkA01G407630|TK1151|PROTEIN

MLYHCRRFLTTEDMFRIIILLGLLVIGKAEIYIVTIEGQPVISYTGGVSGFKATAVESDETLDVTSELVSSYARHLELKHDTLLETLFNQGNYKKLYSYKHLINGFAVDLSPEQAETLRGANGVKSVDKDWKVRKLTTHTPQFLGLPKGVWPMGGGFGRAGEDIVIGFIDSGIFPHHPSFGNHNSEPYGPIPKFRGKCEVDSDTKKSFCNGKIVGAQHFAQAAIAAGVFNPSVDFASPLDGDGHGSHTAAIAAGNNGIPV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G407630`
TK1151 ID	TkA01G407630
OH-1004 ID	LXL04_002984
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G407630

Location Chr01:101767035-101771769 (+)

Description Similar to SBT2.6: Subtilisin-like protease SBT2.6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g30020`	Subtilisin-like protease SBT2.6.	No verified direct reference in this release
`At2g19170`	Subtilisin-like protease SBT2.5.	No verified direct reference in this release
`At4g20430`	Subtilisin-like protease SBT2.2.	No verified direct reference in this release
`At5g44530`	Subtilisin-like protease SBT2.3.	No verified direct reference in this release
`At1g30600`	Subtilisin-like protease SBT2.1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002984 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0004252 serine-type endopeptidase activity Molecular Function

GO:0008236 serine-type peptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G30600

ath:AT2G19170

ath:AT4G20430

ath:AT4G30020

ath:AT5G44530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.649

Rank 1 · TkA01G407630 · TK1151

Lysosome / Vacuole0.143

Rank 2 · TkA01G407630 · TK1151

Cytoplasm0.091

Rank 3 · TkA01G407630 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA01G407630 · TK1151

Cell membrane0.053

Rank 5 · TkA01G407630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05922Inhibitor_I972-134 aa

PF06280fn3_587-110 aa

PF00082Peptidase_S8161-647 aa

PF02225PA424-501 aa

PF06280fn3_5723-818 aa

PF17766fn3_6726-818 aa

PF23619Ig_VWA7742-793 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G407630	`PF05922`	Inhibitor_I9	72	134	9.8e-13	49.3
TkA01G407630	`PF06280`	fn3_5	87	110	1.1e-16	62.2
TkA01G407630	`PF00082`	Peptidase_S8	161	647	3.5e-41	142.1
TkA01G407630	`PF02225`	PA	424	501	2.3e-05	25.1
TkA01G407630	`PF06280`	fn3_5	723	818	1.1e-16	62.2
TkA01G407630	`PF17766`	fn3_6	726	818	1.3e-18	67.8
TkA01G407630	`PF23619`	Ig_VWA7	742	793	0.2	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZV5`	Arabidopsis thaliana	sp\|Q9SZV5\|SBT26_ARATH Subtilisin-like protease SBT2.6	77.300%	Swiss-Prot	High
`O64481`	Arabidopsis thaliana	sp\|O64481\|SBT25_ARATH Subtilisin-like protease SBT2.5	75.700%	Swiss-Prot	High
`Q9SUN6`	Arabidopsis thaliana	sp\|Q9SUN6\|SBT22_ARATH Subtilisin-like protease SBT2.2	47.900%	Swiss-Prot	Medium
`Q9FI12`	Arabidopsis thaliana	sp\|Q9FI12\|SBT23_ARATH Subtilisin-like protease SBT2.3	47.100%	Swiss-Prot	Medium
`Q9SA75`	Arabidopsis thaliana	sp\|Q9SA75\|SBT21_ARATH Subtilisin-like protease SBT2.1	44.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card