TkA01G402800 | RubberDandelionOmics

Gene overview

TkA01G402800

Reference: TK1151 Chr: Chr01 Coordinates: 100629400-100647485 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2508 bp · TkA01G402800|TK1151|cDNA

TTTATCAACAGCTCAGCCTCTACGGTTACCCCCTTGCAATTGTGCACAAGGATTTGAAATATCTCTGAGTCTCTGAAAGTGAAGGAAATAATGTGGAAGCTTCAGCTGTCAAAAGGTGACGATGATCCAGATGTCAGAAGCGTGAATCATCATATGGGTAGGCAATATTGGGAATTCGATCCACATGCAGGAACTCCAGAAGAGCGATCTCAAATCGAGAGCATGCGTGAAGAATTTACCAGAAACAGGTTGAATGTGAC...

CDS

Download CDS FASTA

1692 bp · TkA01G402800|TK1151|CDS

ATGACTAAAGCACAGTCTTGGATTCTTAAACATGGTAGTGTCACACACATACCCTCTTGGGGGAAATTGTGGCTCTCTGTACTTGGTGTGTATGAATGGAAAGGCAACAATCCATTGCCACCAGAAATTTGGCTTCTCCCATACTTTCTTCCTTTACACCCAGGAAGATTGTGGTGCCATACAAGGATGGTATACCTACCAATGTCCTATTTATATGGTAAACGATTTGTCGGGCCAATTAGTTCCATTGTTTTGTCACT...

Protein

Download Protein FASTA

563 aa · TkA01G402800|TK1151|PROTEIN

MTKAQSWILKHGSVTHIPSWGKLWLSVLGVYEWKGNNPLPPEIWLLPYFLPLHPGRLWCHTRMVYLPMSYLYGKRFVGPISSIVLSLRRELYTTLYYQVNWDLARKQCAKDDLYYPHPLIQDLLWGSLNKIVEPLLMQWPFAKLRKEALKTVMQHIHYEDENTNYICIGPVNKVLNMLCCWVEDPKTPINKLHLSRIKDYLWVAEDGMKMQGYNGSQLWDVVFSVQAIVATNLVDEYSSMLHKAHNLIKNSQVKKNSSGN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G402800`
TK1151 ID	TkA01G402800
OH-1004 ID	LXL04_003034
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.000
Protein coverage (%)	TK1151 98.579 / OH-1004 69.987 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G402800

Location Chr01:100629400-100647485 (+)

Description Similar to OSCPNX1: Cycloartenol Synthase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g07050`	Converts oxidosqualene to cycloartenol and 1% parkeol.	Allelic mutant series reveal distinct functions for Arabidopsis cycloartenol synthase 1 in cell viability and plastid biogenesis.2008 · DOI: 10.1073/pnas.0712190105 Isolation of an Arabidopsis thaliana gene encoding cycloartenol synthase by functional expression in a yeast mutant lacking lanosterol synthase by the use of a chromatographic screen.1993 · DOI: 10.1073/pnas.90.24.11628

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003034 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0009555 pollen development Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010686 tetracyclic triterpenoid biosynthetic process Biological Process

GO:0016104 triterpenoid biosynthetic process Biological Process

GO:0016126 sterol biosynthetic process Biological Process

GO:0019745 pentacyclic triterpenoid biosynthetic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G07050

rcu:8262543

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.407

Rank 1 · TkA01G402800 · TK1151

Endoplasmic reticulum0.160

Rank 2 · TkA01G402800 · TK1151

Peroxisome0.140

Rank 3 · TkA01G402800 · TK1151

Cytoplasm0.110

Rank 4 · TkA01G402800 · TK1151

Cell membrane0.053

Rank 5 · TkA01G402800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13249SQHop_cyclase_N1-204 aa

PF00432Prenyltrans210-408 aa

PF13243SQHop_cyclase_C216-553 aa

PF07678TED_complement362-403 aa

PF09492Pec_lyase367-410 aa

PF13249SQHop_cyclase_N368-413 aa

PF07678TED_complement373-495 aa

PF00432Prenyltrans424-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G402800	`PF13249`	SQHop_cyclase_N	1	204	2.2e-25	90.1
TkA01G402800	`PF00432`	Prenyltrans	210	408	4.6e-05	23.7
TkA01G402800	`PF13243`	SQHop_cyclase_C	216	553	3e-49	168.5
TkA01G402800	`PF07678`	TED_complement	362	403	0.0019	18.1
TkA01G402800	`PF09492`	Pec_lyase	367	410	0.0008	19.5
TkA01G402800	`PF13249`	SQHop_cyclase_N	368	413	2.2e-25	90.1
TkA01G402800	`PF07678`	TED_complement	373	495	0.0019	18.1
TkA01G402800	`PF00432`	Prenyltrans	424	522	4.6e-05	23.7
TkA01G402800	`PF09492`	Pec_lyase	438	474	0.0008	19.5
TkA01G402800	`PF13249`	SQHop_cyclase_N	440	462	2.2e-25	90.1
TkA01G402800	`PF09492`	Pec_lyase	498	522	0.0008	19.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P38605`	Arabidopsis thaliana	sp\|P38605\|CAS1_ARATH Cycloartenol synthase	66.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card