TkA01G401680 | RubberDandelionOmics

Gene overview

TkA01G401680

Reference: TK1151 Chr: Chr01 Coordinates: 100351184-100354035 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1588 bp · TkA01G401680|TK1151|cDNA

AATTGATCGAATTTTCGATCCCAAACATTCACGAAATCCATATAAACGATTCAGTATTCACAATGATCAATAATAAGGAATTCTTGATACCCAAAGCCCTTATACATGTGGGTATTATTACTAGTGTGCGTAACATACATTTATAAATAGTGATTAATGGTGCATGAAGCTTGAATACAGAGAGGAATCGAACGAAAAGCGGCAGAACGCCAAGAATAGATGAAGACCTCCGCCGTATTCTCAAACGCCGTCGCCACCAT...

CDS

Download CDS FASTA

699 bp · TkA01G401680|TK1151|CDS

ATGAAGACCTCCGCCGTATTCTCAAACGCCGTCGCCACCATCGGCGGTGGTTTTCGTCGGGAAACGACCAGCATTAGTCTTTTCTCCCGTAATACTCTTTCCCTTCTTCCTCGTAACAAGTTGAAGAAGCTTCAACATCAATTGTGTTTTAATTTTCCAAATACTACTACCACCATTAACAGTACTAGCAATGCACACACTATTGGAATGGACTCTCCTCGCAGTACACCAAGTGATACAATTGACATCAATTGGGACAC...

Protein

Download Protein FASTA

232 aa · TkA01G401680|TK1151|PROTEIN

MKTSAVFSNAVATIGGGFRRETTSISLFSRNTLSLLPRNKLKKLQHQLCFNFPNTTTTINSTSNAHTIGMDSPRSTPSDTIDINWDTIGFGLVQTDYMYTMKCSLGESFSKGELVPFGNINISPCAGVLNYGQGLFEGLKAYRTKDDSILLFRPRENASRMINGAERMCMPSPSIDQFVQAVKKTVLANEKWIPPPGKGSLYIRPLLYREWKCTWSCTSSRVYFSDLCFSCW

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G401680`
TK1151 ID	TkA01G401680
OH-1004 ID	LXL04_005667
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 89.224 / OH-1004 53.906 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G401680

Location Chr01:100351184-100354035 (-)

Description Similar to BCAT5: Branched-chain-amino-acid aminotransferase 5, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65780`	Converts 2-oxo acids to branched-chain amino acids.	No verified direct reference in this release
`At3g49680`	Converts 2-oxo acids to branched-chain amino acids.	Arabidopsis branched-chain aminotransferase 3 functions in both amino acid and glucosinolate biosynthesis.2008 · DOI: 10.1104/pp.107.111609
`At1g50090`	Putative branched-chain-amino-acid aminotransferase 7.	No verified direct reference in this release
`At1g50110`	Converts 2-oxo acids to branched-chain amino acids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005667 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009097 isoleucine biosynthetic process Biological Process

GO:0009098 L-leucine biosynthetic process Biological Process

GO:0009099 L-valine biosynthetic process Biological Process

GO:0071669 plant-type cell wall organization or biogenesis Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004084 branched-chain-amino-acid transaminase activity Molecular Function

GO:0010326 methionine-oxo-acid transaminase activity Molecular Function

GO:0052654 L-leucine-2-oxoglutarate transaminase activity Molecular Function

GO:0052655 L-valine-2-oxoglutarate transaminase activity Molecular Function

KEGG gene cross-reference

ath:AT1G10070

ath:AT3G49680

ath:AT5G65780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.933

Rank 1 · TkA01G401680 · TK1151

Mitochondrion0.098

Rank 2 · TkA01G401680 · TK1151

Cytoplasm0.027

Rank 3 · TkA01G401680 · TK1151

Nucleus0.023

Rank 4 · TkA01G401680 · TK1151

Peroxisome0.010

Rank 5 · TkA01G401680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06946Phage_holin_5_1131-139 aa

PF06946Phage_holin_5_1177-194 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G401680	`PF06946`	Phage_holin_5_1	131	139	0.31	12.2
TkA01G401680	`PF06946`	Phage_holin_5_1	177	194	0.31	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FYA6`	Arabidopsis thaliana	sp\|Q9FYA6\|BCAT5_ARATH Branched-chain-amino-acid aminotransferase 5, chloroplastic	75.400%	Swiss-Prot	Medium
`Q9M401`	Arabidopsis thaliana	sp\|Q9M401\|BCAT3_ARATH Branched-chain-amino-acid aminotransferase 3, chloroplastic	74.000%	Swiss-Prot	Medium
`Q9LPM8`	Arabidopsis thaliana	sp\|Q9LPM8\|BCAT7_ARATH Putative branched-chain-amino-acid aminotransferase 7	70.600%	Swiss-Prot	Medium
`Q9LPM9`	Arabidopsis thaliana	sp\|Q9LPM9\|BCAT6_ARATH Branched-chain-amino-acid aminotransferase 6	62.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card