LXL04_005667 | RubberDandelionOmics

Gene overview

LXL04_005667

Reference: OH-1004 Chr: Chr01 Coordinates: 170686835-170689239 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1155 bp · LXL04_005667|LXL04_005667|OH1004|cDNA

atgaagacCTCCGCCGTATTCTCAAACGCCGTCGCCACCATCGGCGGTGGTTTTCGTCGGGAAACGACCAGCATTAGTCTTTTCTCCCGTAATACTCTTTCCCTTCTTCCTCGTAACAAGTTGAAGAAGCTTCAACATCAATTGTGTTTTAATTTTCCAAATACTACTACCACCATTAACAGTACTAGCAATGCACACACTATTGGAATGGACTCTCCTCGCAGTACACCAAGTGATACAATTGACATCAATTGGGACAC...

CDS

Download CDS FASTA

1155 bp · LXL04_005667|LXL04_005667|OH1004|CDS

ATGAAGACCTCCGCCGTATTCTCAAACGCCGTCGCCACCATCGGCGGTGGTTTTCGTCGGGAAACGACCAGCATTAGTCTTTTCTCCCGTAATACTCTTTCCCTTCTTCCTCGTAACAAGTTGAAGAAGCTTCAACATCAATTGTGTTTTAATTTTCCAAATACTACTACCACCATTAACAGTACTAGCAATGCACACACTATTGGAATGGACTCTCCTCGCAGTACACCAAGTGATACAATTGACATCAATTGGGACAC...

Protein

Download Protein FASTA

384 aa · LXL04_005667|LXL04_005667|OH1004|PROTEIN

MKTSAVFSNAVATIGGGFRRETTSISLFSRNTLSLLPRNKLKKLQHQLCFNFPNTTTTINSTSNAHTIGMDSPRSTPSDTIDINWDTIGFGLVQTDYMYTMKCSLGESFSKGELVPFGNINISPCAGVLNYGQGLFEGLKAYRTKDDSILLFRPRENASRMINGAERMCMPSPSIDQFVQAVKKTVLANEKWIPPPGKGSLYIRPLLIGSGSVLGLAPALEYTFLIYVSPVGNYFNKGLSPINLIIETEMHRATPGGTGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005667`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005667

Location Chr01:170686835-170689239 (+)

Description Similar to BCAT5: Branched-chain-amino-acid aminotransferase 5, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65780`	Converts 2-oxo acids to branched-chain amino acids.	No verified direct reference in this release
`At3g49680`	Converts 2-oxo acids to branched-chain amino acids.	Arabidopsis branched-chain aminotransferase 3 functions in both amino acid and glucosinolate biosynthesis.2008 · DOI: 10.1104/pp.107.111609
`At1g10070`	Converts 2-oxo acids to branched-chain amino acids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005667 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009097 isoleucine biosynthetic process Biological Process

GO:0009098 L-leucine biosynthetic process Biological Process

GO:0009099 L-valine biosynthetic process Biological Process

GO:0071669 plant-type cell wall organization or biogenesis Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004084 branched-chain-amino-acid transaminase activity Molecular Function

GO:0010326 methionine-oxo-acid transaminase activity Molecular Function

GO:0052654 L-leucine-2-oxoglutarate transaminase activity Molecular Function

GO:0052655 L-valine-2-oxoglutarate transaminase activity Molecular Function

KEGG gene cross-reference

ath:AT1G10070

ath:AT3G49680

ath:AT5G65780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.946

Rank 1 · LXL04_005667 · OH-1004

Mitochondrion0.082

Rank 2 · LXL04_005667 · OH-1004

Cytoplasm0.050

Rank 3 · LXL04_005667 · OH-1004

Peroxisome0.032

Rank 4 · LXL04_005667 · OH-1004

Nucleus0.022

Rank 5 · LXL04_005667 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01063.25Aminotran_4134-308 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005667	`PF01063.25`	Aminotran_4	134	308	2.1e-16	61.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FYA6`	Arabidopsis thaliana	Branched-chain-amino-acid aminotransferase 5, chloroplastic	59.500%	Swiss-Prot	strong database homology
`Q9M401`	Arabidopsis thaliana	Branched-chain-amino-acid aminotransferase 3, chloroplastic	62.032%	Swiss-Prot	strong database homology
`Q9M439`	Arabidopsis thaliana	Branched-chain-amino-acid aminotransferase 2, chloroplastic	55.090%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card