TkA01G394590 | RubberDandelionOmics

Gene overview

TkA01G394590

Reference: TK1151 Chr: Chr01 Coordinates: 98413712-98415254 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1009 bp · TkA01G394590|TK1151|cDNA

ATGCATTCTCCTTCTTCTTCTTCTTCTTCTCCTTCAAGAACGAAGGATTGTACTAACAAGTTTGTGATTATAGGACTACCTCTCTCAACTCTTCATTCCTCATCACTCTTGTTCTTCAAACCAACATCCCCCACAGCTATCACTCATTTCCAAACACTGGTCACGGAATCGTCAAATAATTTGATTCGAAACCTCCATAACTCCTTTGATAAATGCCTCAATGTTCTGCATCTCTTGGCCTCTGAAAATCCCCTTTTCGC...

CDS

Download CDS FASTA

819 bp · TkA01G394590|TK1151|CDS

ATGCATTCTCCTTCTTCTTCTTCTTCTTCTCCTTCAAGAACGAAGGATGTATGTGATGATAATCCAGCTGAGAAGGCTGTCAATTGTACTAACAAGTTTGTGATTATAGGACTACCTCTCTCAACTCTTCATTCCTCATCACTCTTGTTCTTCAAACCAACATCCCCCACAGCTATCACTCATTTCCAAACACTGGTCACGGAATCGTCAAATAATTTGATTCGAAACCTCCATAACTCCTTTGATAAATGCCTCAATGT...

Protein

Download Protein FASTA

272 aa · TkA01G394590|TK1151|PROTEIN

MHSPSSSSSSPSRTKDVCDDNPAEKAVNCTNKFVIIGLPLSTLHSSSLLFFKPTSPTAITHFQTLVTESSNNLIRNLHNSFDKCLNVLHLLASENPLFAKLHSISSEYHNFCQINRRNLRELKFVRNHDFAAIIPGDSVAGLVVSNGVLNFLNLYNTLLVVRLVLTWFPNSPPAIVSPLSTICDPYLNIFRGVIPPLGGTLDLSPILAFLVLNALTSTASALPAELPSTDSSSSSSENVTRPFHTEMMSHFTSSQKKWMK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G394590`
TK1151 ID	TkA01G394590
OH-1004 ID	LXL04_003092
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G394590

Location Chr01:98413712-98415254 (+)

Description Similar to YLMG2: YlmG homolog protein 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g21920`	Not required for the biogenesis and accumulation of native cytochrome b6 in the thylakoid membrane.	No verified direct reference in this release
`At3g07430`	Required for the proper distribution of nucleoids in chloroplasts.	The YlmG protein has a conserved function related to the distribution of nucleoids in chloroplasts and cyanobacteria.2010 · DOI: 10.1186/1471-2229-10-57
`At4g27990`	Not required for the biogenesis and accumulation of native cytochrome b6 in the thylakoid membrane.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003092 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010020 chloroplast fission Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

GO:0042651 thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT3G07430

ath:AT4G27990

ath:AT5G21920

bsu:BSU15400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.797

Rank 1 · TkA01G394590 · TK1151

Mitochondrion0.134

Rank 2 · TkA01G394590 · TK1151

Nucleus0.066

Rank 3 · TkA01G394590 · TK1151

Cytoplasm0.040

Rank 4 · TkA01G394590 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA01G394590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10172DDA153-82 aa

PF10172DDA1106-115 aa

PF02325CCB3_YggT148-218 aa

PF10172DDA1225-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G394590	`PF10172`	DDA1	53	82	1.8	9.5
TkA01G394590	`PF10172`	DDA1	106	115	1.8	9.5
TkA01G394590	`PF02325`	CCB3_YggT	148	218	1.1e-18	67.9
TkA01G394590	`PF10172`	DDA1	225	242	1.8	9.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C595`	Arabidopsis thaliana	sp\|Q9C595\|YLMG2_ARATH YlmG homolog protein 2, chloroplastic	62.400%	Swiss-Prot	Medium
`Q9SRS3`	Arabidopsis thaliana	sp\|Q9SRS3\|YMG11_ARATH YlmG homolog protein 1-1, chloroplastic	49.300%	Swiss-Prot	Low
`Q9SUE0`	Arabidopsis thaliana	sp\|Q9SUE0\|YMG12_ARATH YlmG homolog protein 1-2, chloroplastic	49.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card