LXL04_003092 | RubberDandelionOmics

Gene overview

LXL04_003092

Reference: OH-1004 Chr: Chr01 Coordinates: 67266001-67267308 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

822 bp · LXL04_003092|LXL04_003092|OH1004|cDNA

ATGcattctccttcttcttcttcttcttctccttcaaGAACGAAGGATGTATGTGATGATAATCCAGCTGAGAAGGCTGTCAATTGTACTAACAAGTTTGTGATTATAGGACTACCTCTCTCAACTCTTCATTCCTCATCACTCTTGTTCTTCAAACCAACATCCCCCACAGCTATCACTCATTTCCAAACACTGGTCACGGAATCGTCAAATAATTTGATTCGAAACCTCCATAACTCCTTTGATAAATGCCTCAATGT...

CDS

Download CDS FASTA

822 bp · LXL04_003092|LXL04_003092|OH1004|CDS

ATGCATTCTCCTTCTTCTTCTTCTTCTTCTCCTTCAAGAACGAAGGATGTATGTGATGATAATCCAGCTGAGAAGGCTGTCAATTGTACTAACAAGTTTGTGATTATAGGACTACCTCTCTCAACTCTTCATTCCTCATCACTCTTGTTCTTCAAACCAACATCCCCCACAGCTATCACTCATTTCCAAACACTGGTCACGGAATCGTCAAATAATTTGATTCGAAACCTCCATAACTCCTTTGATAAATGCCTCAATGT...

Protein

Download Protein FASTA

273 aa · LXL04_003092|LXL04_003092|OH1004|PROTEIN

MHSPSSSSSSPSRTKDVCDDNPAEKAVNCTNKFVIIGLPLSTLHSSSLLFFKPTSPTAITHFQTLVTESSNNLIRNLHNSFDKCLNVLHLLASENPLFAKLHSISTEYHNFCQINRRNLRELKFVRNHDFAAIIPGDSVAGLVVSNGVLNFLNLYNTLLVVRLVLTWFPNSPPAIVSPLSTICDPYLNIFRGVIPPLGGTLDLSPILAFLVLNALTSTASALPAELPSTDSSSSSSSENVTRPFHTEMMSHFTSSQKKWM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003092`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003092

Location Chr01:67266001-67267308 (-)

Description Similar to YLMG2: YlmG homolog protein 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g21920`	Not required for the biogenesis and accumulation of native cytochrome b6 in the thylakoid membrane.	No verified direct reference in this release
`At3g07430`	Required for the proper distribution of nucleoids in chloroplasts.	The YlmG protein has a conserved function related to the distribution of nucleoids in chloroplasts and cyanobacteria.2010 · DOI: 10.1186/1471-2229-10-57
`At4g27990`	Not required for the biogenesis and accumulation of native cytochrome b6 in the thylakoid membrane.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003092 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010020 chloroplast fission Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

GO:0042651 thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT3G07430

ath:AT4G27990

ath:AT5G21920

bsu:BSU15400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.778

Rank 1 · LXL04_003092 · OH-1004

Mitochondrion0.144

Rank 2 · LXL04_003092 · OH-1004

Nucleus0.067

Rank 3 · LXL04_003092 · OH-1004

Cytoplasm0.042

Rank 4 · LXL04_003092 · OH-1004

Endoplasmic reticulum0.024

Rank 5 · LXL04_003092 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02325.24CCB3_YggT148-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003092	`PF02325.24`	CCB3_YggT	148	218	1.2e-18	67.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C595`	Arabidopsis thaliana	YlmG homolog protein 2, chloroplastic	57.286%	Swiss-Prot	strong database homology
`Q9SRS3`	Arabidopsis thaliana	YlmG homolog protein 1-1, chloroplastic	52.564%	Swiss-Prot	weak database homology
`Q9SUE0`	Arabidopsis thaliana	YlmG homolog protein 1-2, chloroplastic	52.564%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card