RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G394320
Reference: TK1151 Chr: Chr01 Coordinates: 98362541-98366405 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1242 bp · TkA01G394320|TK1151|cDNA

ATGGGAATTGAAGCCGGGGAGTCCTCCGGTGCCGGACGTCCTGAGACGAGTAGTGGTGGAGAAGATGCCGGTCCCACTACCACCCCAACCACTACCTCCAACCCCGTGCGCCGGCGATTCCCGCTGGCTGCTCAGCCGGAGATAATGAGAGCGGCGCAGAAGGATGACCAGTATGCTTCTTTCGTCTACGAGGCCTGTCGTACAAGGGCAGCTATATCGTATCAGAGTGAGACAAAACTATTGGGGCAAATGCTGTATTA...

CDS

Download CDS FASTA

1242 bp · TkA01G394320|TK1151|CDS

ATGGGAATTGAAGCCGGGGAGTCCTCCGGTGCCGGACGTCCTGAGACGAGTAGTGGTGGAGAAGATGCCGGTCCCACTACCACCCCAACCACTACCTCCAACCCCGTGCGCCGGCGATTCCCGCTGGCTGCTCAGCCGGAGATAATGAGAGCGGCGCAGAAGGATGACCAGTATGCTTCTTTCGTCTACGAGGCCTGTCGTACAAGGGCAGCTATATCGTATCAGAGTGAGACAAAACTATTGGGGCAAATGCTGTATTA...

Protein

Download Protein FASTA

413 aa · TkA01G394320|TK1151|PROTEIN

MGIEAGESSGAGRPETSSGGEDAGPTTTPTTTSNPVRRRFPLAAQPEIMRAAQKDDQYASFVYEACRTRAAISYQSETKLLGQMLYYILTTGAGQQTLGEEYCDVTQVAGLHGLPPTPARRALFIVYQSAVPYIAERVSSRIASRGIALTESMSDDIHGQQASSSSSSSSSSSSSSSSPVVSISPLSRLKEKISSLWLHTVERWPAMLPLAREFLQLLLRANLMFFYFEGLYYHISKRAAGIRYVFIGKPMNQRPRYQIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G394320
TK1151 IDTkA01G394320
OH-1004 IDLXL04_003093
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)87.000
Protein coverage (%)TK1151 95.400 / OH-1004 99.767
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G394320
LocationChr01:98362541-98366405 (-)
DescriptionSimilar to PEX10: Peroxisome biogenesis factor 10
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g26350 E3 ubiquitin-protein ligase component of a retrotranslocation channel required for peroxisome organization by mediating export of the PEX5 receptor from peroxisomes to the cytosol, thereby promoting PEX5 recycling.
AthPEX10, a nuclear gene essential for peroxisome and storage organelle formation during Arabidopsis embryogenesis.2003 · DOI: 10.1073/pnas.1633697100
An Arabidopsis pex10 null mutant is embryo lethal, implicating peroxisomes in an essential role during plant embryogenesis.2003 · DOI: 10.1104/pp.103.031252
Requirement of the C3HC4 zinc RING finger of the Arabidopsis PEX10 for photorespiration and leaf peroxisome contact with chloroplasts.2007 · DOI: 10.1073/pnas.0610402104
Functional classification of Arabidopsis peroxisome biogenesis factors proposed from analyses of knockdown mutants.2007 · DOI: 10.1093/pcp/pcm053
Different functions of the C3HC4 zinc RING finger peroxins PEX10, PEX2, and PEX12 in peroxisome formation and matrix protein import.2010 · DOI: 10.1073/pnas.1009174107
Arabidopsis RING peroxins are E3 ubiquitin ligases that interact with two homologous ubiquitin receptor proteins(F).2013 · DOI: 10.1111/jipb.12014
Peroxisomal ubiquitin-protein ligases peroxin2 and peroxin10 have distinct but synergistic roles in matrix protein import and peroxin5 retrotranslocation in Arabidopsis.2014 · DOI: 10.1104/pp.114.247148

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_003093 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000209 protein polyubiquitination Biological Process
GO:0006513 protein monoubiquitination Biological Process
GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process
GO:0006635 fatty acid beta-oxidation Biological Process
GO:0007031 peroxisome organization Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0009853 photorespiration Biological Process
GO:0010381 peroxisome-chloroplast membrane tethering Biological Process
GO:0016558 protein import into peroxisome matrix Biological Process
GO:0016562 protein import into peroxisome matrix, receptor recycling Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0034614 cellular response to reactive oxygen species Biological Process
KEGG gene cross-reference
ath:AT2G26350
ddi:DDB_G0282693
hsa:5192
xla:108697631
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.704
Rank 1 · TkA01G394320 · TK1151
Mitochondrion0.119
Rank 2 · TkA01G394320 · TK1151
Nucleus0.114
Rank 3 · TkA01G394320 · TK1151
Endoplasmic reticulum0.104
Rank 4 · TkA01G394320 · TK1151
Cytoplasm0.092
Rank 5 · TkA01G394320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04757Pex2_Pex1268-276 aa
PF04564U-box184-195 aa
PF13920zf-C3HC4_3339-384 aa
PF12678zf-rbx1339-379 aa
PF11789zf-Nse339-378 aa
PF13639zf-RING_2340-379 aa
PF13923zf-C3HC4_2340-378 aa
PF14634zf-RING_5340-379 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G394320PF04757Pex2_Pex12682763.4e-35122.4
TkA01G394320PF04564U-box1841950.08713.7
TkA01G394320PF13920zf-C3HC4_33393841.6e-0938.1
TkA01G394320PF12678zf-rbx13393791.7e-0525.7
TkA01G394320PF11789zf-Nse3393783.58.3
TkA01G394320PF13639zf-RING_23403793.1e-1040.9
TkA01G394320PF13923zf-C3HC4_23403783.1e-0834.0
TkA01G394320PF14634zf-RING_53403796.8e-0523.5
TkA01G394320PF14835zf-RING_63403810.2611.9
TkA01G394320PF00097zf-C3HC43413785.4e-0833.3
TkA01G394320PF13445zf-RING_UBOX3413761.2e-0629.1
TkA01G394320PF24921RING_XB3-XBAT313413821.2e-0525.9
TkA01G394320PF15227zf-C3HC4_43413782.9e-0524.8
TkA01G394320PF14447Prok-RING_43413820.0007420.1
TkA01G394320PF16685zf-RING_103413800.2412.2
TkA01G394320PF17123zf-RING_113413651.49.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SYU4Arabidopsis thalianasp|Q9SYU4|PEX10_ARATH Peroxisome biogenesis factor 1068.100%Swiss-ProtHigh

JBrowse

View in Genome Browser