LXL04_003093 | RubberDandelionOmics

Gene overview

LXL04_003093

Reference: OH-1004 Chr: Chr01 Coordinates: 67283727-67286943 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · LXL04_003093|LXL04_003093|OH1004|cDNA

ATGGGAATTGAAGCCGGGGAGTCCTCCGGTGCCGGACGTCCTGAGACGAGTAGTGGTGGAGAAGATGCCGGTCCCACTACCACCCCAACCACTACCTCCAACCCCGTGCGCCGGCGATTCCCGCTGGCTGCTCAGCCGGAGATAATGAGAGCGGCGCAGAAGGATGACCAGTATGCTTCTTTCGTCTACGAGGCCTGTCGTGACGCCTTTCGCCACTTATTCGGTCTCTTATCTTATCTCAAATTTAGGGCTTTGCTTCT...

CDS

Download CDS FASTA

1293 bp · LXL04_003093|LXL04_003093|OH1004|CDS

ATGGGAATTGAAGCCGGGGAGTCCTCCGGTGCCGGACGTCCTGAGACGAGTAGTGGTGGAGAAGATGCCGGTCCCACTACCACCCCAACCACTACCTCCAACCCCGTGCGCCGGCGATTCCCGCTGGCTGCTCAGCCGGAGATAATGAGAGCGGCGCAGAAGGATGACCAGTATGCTTCTTTCGTCTACGAGGCCTGTCGTGACGCCTTTCGCCACTTATTCGGTCTCTTATCTTATCTCAAATTTAGGGCTTTGCTTCT...

Protein

Download Protein FASTA

430 aa · LXL04_003093|LXL04_003093|OH1004|PROTEIN

MGIEAGESSGAGRPETSSGGEDAGPTTTPTTTSNPVRRRFPLAAQPEIMRAAQKDDQYASFVYEACRDAFRHLFGLLSYLKFRALLLPALYRTTCASRCIFNFYRYVVSGTRAAISYQSETKLLGQMLYYILTTGAGQQTLGEEYCDVTQVAGLHGLPPTPARRALFIVYQSAVPYIAERVSSRIASRGIALTESMSDDIHGQQASSSSSSSSPVVSISPLSRLKEKISSLWLHTVERWPAMLPLAREFLQLLLRANLMF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003093`
TK1151 ID	TkA01G394320
OH-1004 ID	LXL04_003093
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.000
Protein coverage (%)	TK1151 95.400 / OH-1004 99.767 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003093

Location Chr01:67283727-67286943 (+)

Description Similar to PEX10: Peroxisome biogenesis factor 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26350`	E3 ubiquitin-protein ligase component of a retrotranslocation channel required for peroxisome organization by mediating export of the PEX5 receptor from peroxisomes to the cytosol, thereby promoting PEX5 recycling.	AthPEX10, a nuclear gene essential for peroxisome and storage organelle formation during Arabidopsis embryogenesis.2003 · DOI: 10.1073/pnas.1633697100 An Arabidopsis pex10 null mutant is embryo lethal, implicating peroxisomes in an essential role during plant embryogenesis.2003 · DOI: 10.1104/pp.103.031252 Requirement of the C3HC4 zinc RING finger of the Arabidopsis PEX10 for photorespiration and leaf peroxisome contact with chloroplasts.2007 · DOI: 10.1073/pnas.0610402104 Functional classification of Arabidopsis peroxisome biogenesis factors proposed from analyses of knockdown mutants.2007 · DOI: 10.1093/pcp/pcm053 Different functions of the C3HC4 zinc RING finger peroxins PEX10, PEX2, and PEX12 in peroxisome formation and matrix protein import.2010 · DOI: 10.1073/pnas.1009174107 Arabidopsis RING peroxins are E3 ubiquitin ligases that interact with two homologous ubiquitin receptor proteins(F).2013 · DOI: 10.1111/jipb.12014 Peroxisomal ubiquitin-protein ligases peroxin2 and peroxin10 have distinct but synergistic roles in matrix protein import and peroxin5 retrotranslocation in Arabidopsis.2014 · DOI: 10.1104/pp.114.247148

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003093 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006513 protein monoubiquitination Biological Process

GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0007031 peroxisome organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009853 photorespiration Biological Process

GO:0010381 peroxisome-chloroplast membrane tethering Biological Process

GO:0016558 protein import into peroxisome matrix Biological Process

GO:0016562 protein import into peroxisome matrix, receptor recycling Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0034614 cellular response to reactive oxygen species Biological Process

KEGG gene cross-reference

ath:AT2G26350

ddi:DDB_G0282693

hsa:5192

xla:108697631

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.709

Rank 1 · LXL04_003093 · OH-1004

Mitochondrion0.115

Rank 2 · LXL04_003093 · OH-1004

Nucleus0.110

Rank 3 · LXL04_003093 · OH-1004

Endoplasmic reticulum0.106

Rank 4 · LXL04_003093 · OH-1004

Cytoplasm0.085

Rank 5 · LXL04_003093 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04757.20Pex2_Pex1255-311 aa

PF13920.13zf-C3HC4_3374-419 aa

PF13639.13zf-RING_2375-414 aa

PF13923.13zf-C3HC4_2375-413 aa

PF00097.32zf-C3HC4376-413 aa

PF13445.13zf-RING_UBOX376-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003093	`PF04757.20`	Pex2_Pex12	55	311	3.3e-36	125.8
LXL04_003093	`PF13920.13`	zf-C3HC4_3	374	419	1.5e-09	38.2
LXL04_003093	`PF13639.13`	zf-RING_2	375	414	2.8e-10	41.0
LXL04_003093	`PF13923.13`	zf-C3HC4_2	375	413	3e-08	34.1
LXL04_003093	`PF00097.32`	zf-C3HC4	376	413	4.2e-08	33.6
LXL04_003093	`PF13445.13`	zf-RING_UBOX	376	411	9e-07	29.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYU4`	Arabidopsis thaliana	Peroxisome biogenesis factor 10	60.514%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card