TkA01G389330 | RubberDandelionOmics

Gene overview

TkA01G389330

Reference: TK1151 Chr: Chr01 Coordinates: 97179644-97182211 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1036 bp · TkA01G389330|TK1151|cDNA

GTTAAACTCCAAAGAAAGTCTAATCCATCAACCTACAATCAAATACGAAAGCACTCCGAAACATTCACGCACTGCTGCTGATTTCCATCGACTCGGTGGATAACTTGTGGGTCTAGTTTTATGTTTTTGGGCAGCGATGGTGGCCGCAGAGAGTAATACATGTATCAATAGCGGTTGAATACGTTTGATGGATTAGGAAGAGCTCACTTCTCCAAACAATTGTTTAATTTTTGGAAACACCCAATCTGGATTCTCTGATT...

CDS

Download CDS FASTA

516 bp · TkA01G389330|TK1151|CDS

ATGGATGAATTTGATAACCTCTACAAGGAGCGCATTGCTGCACTTCTTAGAGTAATGTATGCCACAAAGTATGTTAAAGATGATAATGTTCCAGCTCAAATTGAAGAGGGTCTCTATTTGGGTTCTGTTGGAGCTGCCCATAACAAGACTCTTTTAAAAAGCTTGAATGTCACCCACATCTTAACTGTTGCCAATTCACTACCTCCTACATTTCCCAATGATTTCACTTACAAAATTGTTGATATTCCGGATAAAGAGCA...

Protein

Download Protein FASTA

171 aa · TkA01G389330|TK1151|PROTEIN

MDEFDNLYKERIAALLRVMYATKYVKDDNVPAQIEEGLYLGSVGAAHNKTLLKSLNVTHILTVANSLPPTFPNDFTYKIVDIPDKEHVNIAQFFDECFGFIEEAKRTGGVLVHCFVGRSRSVTIVVAYLMKKNGMSLSEALNLVKSKRSVASPNSGFMLQLQNYEKSLPGA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G389330`
TK1151 ID	TkA01G389330
OH-1004 ID	LXL04_003161
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G389330

Location Chr01:97179644-97182211 (+)

Description Similar to DSPTP1: Dual specificity protein phosphatase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23610`	Has a dual specificity toward Ser/Thr and Tyr-containing proteins.	Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis.1998 · DOI: 10.1046/j.1365-313x.1998.00327.x
`At3g06110`	Has a dual specificity toward Ser/Thr and Tyr-containing proteins.	Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs.2007 · DOI: 10.1074/jbc.m701888200 MAPK phosphatase MKP2 mediates disease responses in Arabidopsis and functionally interacts with MPK3 and MPK6.2010 · DOI: 10.1111/j.1365-313x.2010.04297.x Regulation of MAPK signaling and cell death by MAPK phosphatase MKP2.2010 · DOI: 10.4161/psb.5.11.13645

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003161 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007254 JNK cascade Biological Process

GO:0010193 response to ozone Biological Process

GO:0034051 negative regulation of plant-type hypersensitive response Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0043327 chemotaxis to cAMP Biological Process

GO:0043409 negative regulation of MAPK cascade Biological Process

GO:0043410 positive regulation of MAPK cascade Biological Process

GO:0046328 regulation of JNK cascade Biological Process

GO:0046329 negative regulation of JNK cascade Biological Process

KEGG gene cross-reference

ath:AT3G06110

ath:AT3G23610

ddi:DDB_G0269918

hsa:142679

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.702

Rank 1 · TkA01G389330 · TK1151

Nucleus0.320

Rank 2 · TkA01G389330 · TK1151

Mitochondrion0.105

Rank 3 · TkA01G389330 · TK1151

Cell membrane0.087

Rank 4 · TkA01G389330 · TK1151

Endoplasmic reticulum0.065

Rank 5 · TkA01G389330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22785Tc-R-P2-31 aa

PF00782DSPc38-166 aa

PF22784PTP-SAK47-135 aa

PF22785Tc-R-P73-131 aa

PF04179Init_tRNA_PT89-133 aa

PF14566PTPlike_phytase92-130 aa

PF00102Y_phosphatase102-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G389330	`PF22785`	Tc-R-P	2	31	0.0011	20.1
TkA01G389330	`PF00782`	DSPc	38	166	6e-32	111.0
TkA01G389330	`PF22784`	PTP-SAK	47	135	0.00023	21.9
TkA01G389330	`PF22785`	Tc-R-P	73	131	0.0011	20.1
TkA01G389330	`PF04179`	Init_tRNA_PT	89	133	0.21	12.5
TkA01G389330	`PF14566`	PTPlike_phytase	92	130	0.14	13.0
TkA01G389330	`PF00102`	Y_phosphatase	102	132	0.081	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZR37`	Arabidopsis thaliana	sp\|Q9ZR37\|DUS1_ARATH Dual specificity protein phosphatase 1	62.700%	Swiss-Prot	High
`Q9M8K7`	Arabidopsis thaliana	sp\|Q9M8K7\|DUS1B_ARATH Dual specificity protein phosphatase 1B	55.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card