Gene Card
Gene overview
cDNA / CDS / Protein Sequences
516 bp · LXL04_003161|LXL04_003161|OH1004|cDNA
ATGGATGAATTTGATAACCTCTACAAGGAGCGCATTGCTGCACTTCTTAGAGTAATGTATGCCACAAAGTATGTTAAAGATGATAATGTTCCAGCTCAAATTGAAGAGGGTCTCTATTTGGGTTCTGTTGGAGCTGCCCATAACAAGACTCTTTTAAAAAGCTTGAATGTCACCCACATCTTAACTGTTGCCAATTCACTACCTCCTACATTTCCCAATGATTTCACTTACAAAATTGTTGATATTCCGGATAAAGAGCA...
516 bp · LXL04_003161|LXL04_003161|OH1004|CDS
ATGGATGAATTTGATAACCTCTACAAGGAGCGCATTGCTGCACTTCTTAGAGTAATGTATGCCACAAAGTATGTTAAAGATGATAATGTTCCAGCTCAAATTGAAGAGGGTCTCTATTTGGGTTCTGTTGGAGCTGCCCATAACAAGACTCTTTTAAAAAGCTTGAATGTCACCCACATCTTAACTGTTGCCAATTCACTACCTCCTACATTTCCCAATGATTTCACTTACAAAATTGTTGATATTCCGGATAAAGAGCA...
Protein
Download Protein FASTA171 aa · LXL04_003161|LXL04_003161|OH1004|PROTEIN
MDEFDNLYKERIAALLRVMYATKYVKDDNVPAQIEEGLYLGSVGAAHNKTLLKSLNVTHILTVANSLPPTFPNDFTYKIVDIPDKEHVNIAQFFDECFGFIEEAKRTGGVLVHCFVGRSRSVTIVVAYLMKKNGMSLSEALNLVKSKRSVASPNSGFMLQLQNYEKSLPGA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_003161 |
|---|---|
| TK1151 ID | TkA01G389330 |
| OH-1004 ID | LXL04_003161 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_003161 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:69791890-69793648 (-) | |||||||||
| Description | Similar to DSPTP1: Dual specificity protein phosphatase 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006470 protein dephosphorylation Biological Process GO:0006979 response to oxidative stress Biological Process GO:0007254 JNK cascade Biological Process GO:0010193 response to ozone Biological Process GO:0034051 negative regulation of plant-type hypersensitive response Biological Process GO:0034599 cellular response to oxidative stress Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0043327 chemotaxis to cAMP Biological Process GO:0043409 negative regulation of MAPK cascade Biological Process GO:0043410 positive regulation of MAPK cascade Biological Process GO:0046328 regulation of JNK cascade Biological Process GO:0046329 negative regulation of JNK cascade Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G06110 ath:AT3G23610 ddi:DDB_G0269918 hsa:142679 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00782.26DSPc38-166 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_003161 | PF00782.26 | DSPc | 38 | 166 | 6e-32 | 111.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.