TkA01G387470 | RubberDandelionOmics

Gene overview

TkA01G387470

Reference: TK1151 Chr: Chr01 Coordinates: 96693791-96697750 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1206 bp · TkA01G387470|TK1151|cDNA

CCCTTTTCTATAAATTTCAGGACATCCCGTTGATCACTCTCTCATGTTATATATCAGTTCTCCGTTTCCATTGAAGAAAGAGAGATTATTTATTTTTCGGAAGTGTAGTTCAGAATGTTGGGGGTATTCAGCGGTTCAATAGTCTCTCCGCCGGAGGAGCTAGTGGCAGCCGGAAGTAGGACACCGTCGCCGAAGATCACAGCTAAGGCGCTCGTTAATCGGTTCATAGGAAACAACGCCTCGGCGGTATCGATGCAGAT...

CDS

Download CDS FASTA

711 bp · TkA01G387470|TK1151|CDS

ATGTTGGGGGTATTCAGCGGTTCAATAGTCTCTCCGCCGGAGGAGCTAGTGGCAGCCGGAAGTAGGACACCGTCGCCGAAGATCACAGCTAAGGCGCTCGTTAATCGGTTCATAGGAAACAACGCCTCGGCGGTATCGATGCAGATCGGAGACGATGTTCAATTGGCGTATACTCACCACAACGAGTCGATCACGCACCCAAGATCTTTTGCGGTCAAAGACGAGATATTTTGTTTGTTCGAAGGTGCACTTGATAACTT...

Protein

Download Protein FASTA

236 aa · TkA01G387470|TK1151|PROTEIN

MLGVFSGSIVSPPEELVAAGSRTPSPKITAKALVNRFIGNNASAVSMQIGDDVQLAYTHHNESITHPRSFAVKDEIFCLFEGALDNLGSLKQQYGLSKSANEVVLVIEAYKALRDRAPYSANHMVGHLIGNFAFVVFDKSTSTLFVATDQHGKVPLYWGITADGCVAFANDADLLKGACGKSLASFPEGCFFSTAVGELRCYENPKNKITAVPATEEEIWGAKFMVEGTSIITATP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G387470`
TK1151 ID	TkA01G387470
OH-1004 ID	LXL04_003175
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G387470`
Location	Chr01:96693791-96697750 (-)
Description	Similar to TSJT1: Stem-specific protein TSJT1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_003175` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006950 response to stress Biological Process GO:0042538 hyperosmotic salinity response Biological Process GO:0070981 L-asparagine biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0009506 plasmodesma Cellular Component GO:0010494 cytoplasmic stress granule Cellular Component GO:0045335 phagocytic vesicle Cellular Component GO:0004066 asparagine synthase (glutamine-hydrolyzing) activity Molecular Function GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference	ath:AT5G65010 ddi:DDB_G0286059 dosa:Os03g0291500 dosa:Os06g0265000 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · TkA01G387470 · TK1151

Nucleus0.278

Rank 2 · TkA01G387470 · TK1151

Cell membrane0.140

Rank 3 · TkA01G387470 · TK1151

Endoplasmic reticulum0.109

Rank 4 · TkA01G387470 · TK1151

Lysosome / Vacuole0.103

Rank 5 · TkA01G387470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12481DUF37002-226 aa

PF11685DUF328130-102 aa

PF13537GATase_773-174 aa

PF13522GATase_679-179 aa

PF11685DUF3281155-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G387470	`PF12481`	DUF3700	2	226	3.6e-91	305.4
TkA01G387470	`PF11685`	DUF3281	30	102	0.19	11.8
TkA01G387470	`PF13537`	GATase_7	73	174	8.1e-12	46.0
TkA01G387470	`PF13522`	GATase_6	79	179	2.4e-10	40.9
TkA01G387470	`PF11685`	DUF3281	155	172	0.19	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card