LXL04_003175 | RubberDandelionOmics

Gene overview

LXL04_003175

Reference: OH-1004 Chr: Chr01 Coordinates: 70312382-70315837 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

711 bp · LXL04_003175|LXL04_003175|OH1004|cDNA

ATGTTGGGGGTATTCAGCGGTTCAATAGTCTCTCCGCCGGAGGAGCTAGTGGCAGCCGGAAGTAGGACACCGTCGCCGAAGATCACAGCTAAGGCGCTCGTTAATCGGTTCATAGGAAACAACGCCTCGGCGGTATCGATGCAGATCGGAGACGATGTTCAATTGGCGTATACTCACCACAACGAGTCGATCACGCACCCAAGATCTTTTGCGGTCAAAGACGAGATATTTTGTTTGTTCGAAGGTGCACTTGATAACTT...

CDS

Download CDS FASTA

711 bp · LXL04_003175|LXL04_003175|OH1004|CDS

ATGTTGGGGGTATTCAGCGGTTCAATAGTCTCTCCGCCGGAGGAGCTAGTGGCAGCCGGAAGTAGGACACCGTCGCCGAAGATCACAGCTAAGGCGCTCGTTAATCGGTTCATAGGAAACAACGCCTCGGCGGTATCGATGCAGATCGGAGACGATGTTCAATTGGCGTATACTCACCACAACGAGTCGATCACGCACCCAAGATCTTTTGCGGTCAAAGACGAGATATTTTGTTTGTTCGAAGGTGCACTTGATAACTT...

Protein

Download Protein FASTA

236 aa · LXL04_003175|LXL04_003175|OH1004|PROTEIN

MLGVFSGSIVSPPEELVAAGSRTPSPKITAKALVNRFIGNNASAVSMQIGDDVQLAYTHHNESITHPRSFAVKDEIFCLFEGALDNLGSLKQQYGLSKSANEVVLVIEAYKALRDRAPYSANHMVGHLIGNFAFVVFDKSTSTLFVATDQHGKVPLYWGITADGCVAFANDADLLKGACGKSLASFPEGCFFSTAVGELRCYENPKNKITAVPATEEEIWGAKFMVEGTSIITATP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003175`
TK1151 ID	TkA01G387470
OH-1004 ID	LXL04_003175
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003175

Location Chr01:70312382-70315837 (+)

Description Similar to TSJT1: Stem-specific protein TSJT1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65010`	Essential for nitrogen assimilation, distribution and remobilization within the plant via the phloem.	Arabidopsis thaliana ASN2 encoding asparagine synthetase is involved in the control of nitrogen assimilation and export during vegetative growth.2013 · DOI: 10.1111/j.1365-3040.2012.02576.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0265000`	Essential for nitrogen assimilation, distribution and remobilization within the plant via the phloem.	No verified direct reference in this release
`Os03g0291500`	Essential for nitrogen assimilation, distribution and remobilization within the plant via the phloem.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003175 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0070981 L-asparagine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0045335 phagocytic vesicle Cellular Component

GO:0004066 asparagine synthase (glutamine-hydrolyzing) activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G65010

ddi:DDB_G0286059

dosa:Os03g0291500

dosa:Os06g0265000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · LXL04_003175 · OH-1004

Nucleus0.278

Rank 2 · LXL04_003175 · OH-1004

Cell membrane0.140

Rank 3 · LXL04_003175 · OH-1004

Endoplasmic reticulum0.109

Rank 4 · LXL04_003175 · OH-1004

Lysosome / Vacuole0.103

Rank 5 · LXL04_003175 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12481.14DUF37002-226 aa

PF13537.12GATase_773-174 aa

PF13522.13GATase_679-179 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003175	`PF12481.14`	DUF3700	2	226	3.6e-91	305.4
LXL04_003175	`PF13537.12`	GATase_7	73	174	8.1e-12	46.0
LXL04_003175	`PF13522.13`	GATase_6	79	179	2.4e-10	40.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV77`	Arabidopsis thaliana	Asparagine synthetase [glutamine-hydrolyzing] 2	36.957%	Swiss-Prot	weak database homology
`Q43011`	Oryza sativa subsp. japonica	Asparagine synthetase [glutamine-hydrolyzing] 2	36.264%	Swiss-Prot	weak database homology
`Q10MX3`	Oryza sativa subsp. japonica	Asparagine synthetase [glutamine-hydrolyzing] 1	38.462%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card