TkA01G385620 | RubberDandelionOmics

Gene overview

TkA01G385620

Reference: TK1151 Chr: Chr01 Coordinates: 96234794-96237393 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2325 bp · TkA01G385620|TK1151|cDNA

AAACGTAAAGACCGTGAGGGCTGACTAAAGACGAGATGGAAAAGACCGAGCCGAAATGAGACTGGTCCAAAAACCAGATGAGAAAAAGATCAACGAAGACCGATTTAAAAAGGACTCAACCGTTTTGAGACCAGTTCCAAAAAAAACGGAACCATTCAAAACCGATCCAAAACGAATCCAGGTCCTCAAAATATGCACATCTCCTAGCGTCCAGGTGGAACAACGCCTCTAGTCCAAGGCCCAATTGTAATGCAAATCAC...

CDS

Download CDS FASTA

1266 bp · TkA01G385620|TK1151|CDS

ATGTCAAATGAAAGTGAGTATGGAACTCTTCTGAGCATGAAGAAATCCGAGCTAGCGAAGGCATCAAAACGCGAAGATGGGGTTGATTTGATCAGTAAAATGCCGGATGCTATTCTTCTTTTGATTCTTTCACGTCTTTCATCCATTGAAGAACAAATCCGAAGCAGCATTTTGTCCAGACGATGGAGGCATTTGTGGACTGCAATTCCTTCTCTAGACATAAGTTATACAGAGATACGTTACGGAGGAAAATTAAAAAA...

Protein

Download Protein FASTA

421 aa · TkA01G385620|TK1151|PROTEIN

MSNESEYGTLLSMKKSELAKASKREDGVDLISKMPDAILLLILSRLSSIEEQIRSSILSRRWRHLWTAIPSLDISYTEIRYGGKLKKGEFKEFVYWVLVNKSVDLDSFRLFCANYYSMSTVWRWVHVAVKRNVKQLNFFFYTKEKTEAVELPHCLVSCASLEVLKLNLRNRGLIWPKVMGFPALRVLDLTDVDLLEDEDLVKRILESCPLLEDLSFLECGLRKLDRLCISCPKLKRLSIINWEDMGCHGIEISCPELVDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G385620`
TK1151 ID	TkA01G385620
OH-1004 ID	LXL04_003210
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	90.000
Protein coverage (%)	TK1151 99.762 / OH-1004 49.646 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G385620

Location Chr01:96234794-96237393 (-)

Description Similar to At5g56560: Putative FBD-associated F-box protein At5g56560

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release
`At5g44950`	Putative F-box/FBD/LRR-repeat protein At5g44950.	No verified direct reference in this release
`At2g04230`	F-box/FBD/LRR-repeat protein At2g04230.	No verified direct reference in this release
`At3g28410`	Putative F-box/LRR-repeat protein At3g28410.	No verified direct reference in this release
`At5g02700`	Putative F-box/LRR-repeat protein At5g02700.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003210 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G69630

ath:AT2G26860

ath:AT5G56560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.872

Rank 1 · TkA01G385620 · TK1151

Cytoplasm0.171

Rank 2 · TkA01G385620 · TK1151

Cell membrane0.042

Rank 3 · TkA01G385620 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA01G385620 · TK1151

Plastid0.016

Rank 5 · TkA01G385620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23622LRR_At1g61320_AtMIF130-65 aa

PF00646F-box31-67 aa

PF12937F-box-like31-65 aa

PF23622LRR_At1g61320_AtMIF1101-382 aa

PF07723LRR_2101-112 aa

PF24758LRR_At5g56370123-260 aa

PF23320Zn_SUZ12142-168 aa

PF12799LRR_4155-167 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G385620	`PF23622`	LRR_At1g61320_AtMIF1	30	65	2.2e-14	54.3
TkA01G385620	`PF00646`	F-box	31	67	7.8e-06	26.3
TkA01G385620	`PF12937`	F-box-like	31	65	0.0011	19.4
TkA01G385620	`PF23622`	LRR_At1g61320_AtMIF1	101	382	2.2e-14	54.3
TkA01G385620	`PF07723`	LRR_2	101	112	0.28	12.6
TkA01G385620	`PF24758`	LRR_At5g56370	123	260	1.1e-17	65.1
TkA01G385620	`PF23320`	Zn_SUZ12	142	168	0.12	12.9
TkA01G385620	`PF12799`	LRR_4	155	167	0.0048	17.8
TkA01G385620	`PF12799`	LRR_4	170	194	0.0048	17.8
TkA01G385620	`PF07723`	LRR_2	184	209	0.28	12.6
TkA01G385620	`PF00646`	F-box	198	212	7.8e-06	26.3
TkA01G385620	`PF12799`	LRR_4	211	239	0.0048	17.8
TkA01G385620	`PF24758`	LRR_At5g56370	222	282	1.1e-17	65.1
TkA01G385620	`PF12799`	LRR_4	253	265	0.0048	17.8
TkA01G385620	`PF24758`	LRR_At5g56370	314	364	1.1e-17	65.1
TkA01G385620	`PF12799`	LRR_4	322	334	0.0048	17.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FM89`	Arabidopsis thaliana	sp\|Q9FM89\|FDL38_ARATH F-box/FBD/LRR-repeat protein At5g56420	33.500%	Swiss-Prot	Low
`Q9FLA2`	Arabidopsis thaliana	sp\|Q9FLA2\|FDL34_ARATH Putative F-box/FBD/LRR-repeat protein At5g44950	32.000%	Swiss-Prot	Low
`Q6NKX3`	Arabidopsis thaliana	sp\|Q6NKX3\|FDL14_ARATH F-box/FBD/LRR-repeat protein At2g04230	37.200%	Swiss-Prot	Low
`Q9LSJ3`	Arabidopsis thaliana	sp\|Q9LSJ3\|FBL48_ARATH Putative F-box/LRR-repeat protein At3g28410	33.300%	Swiss-Prot	Low
`Q9LZ15`	Arabidopsis thaliana	sp\|Q9LZ15\|FBL78_ARATH Putative F-box/LRR-repeat protein At5g02700	30.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card