LXL04_003210 | RubberDandelionOmics

Gene overview

LXL04_003210

Reference: OH-1004 Chr: Chr01 Coordinates: 70945143-70951125 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2547 bp · LXL04_003210|LXL04_003210|OH1004|cDNA

ATGGCAAATGAAAGTGAGTATGGAACTCTTCTGAGCATGAAGAAATCCGAGCTAGCGAAGGCATCAAAACGCGAAGATGGGGTTGATTTGATCAGTAAAATGCCGGATGCTattcttcttctgattcttTCACGTGTTTCATCCATTGAAGAACAAATCCGAAGCAGCATTTTGTCCAGACGATGGAGGCATTTGTGGACTGCAATTCCTTCTCTAGACATAAGTTATACAGAAATACGTTACGGAGGAAAGTTCAAAAA...

CDS

Download CDS FASTA

2547 bp · LXL04_003210|LXL04_003210|OH1004|CDS

ATGGCAAATGAAAGTGAGTATGGAACTCTTCTGAGCATGAAGAAATCCGAGCTAGCGAAGGCATCAAAACGCGAAGATGGGGTTGATTTGATCAGTAAAATGCCGGATGCTATTCTTCTTCTGATTCTTTCACGTGTTTCATCCATTGAAGAACAAATCCGAAGCAGCATTTTGTCCAGACGATGGAGGCATTTGTGGACTGCAATTCCTTCTCTAGACATAAGTTATACAGAAATACGTTACGGAGGAAAGTTCAAAAA...

Protein

Download Protein FASTA

848 aa · LXL04_003210|LXL04_003210|OH1004|PROTEIN

MANESEYGTLLSMKKSELAKASKREDGVDLISKMPDAILLLILSRVSSIEEQIRSSILSRRWRHLWTAIPSLDISYTEIRYGGKFKKGEFKEFVYWVLVNKSVDLDSFRLRCADYYSMSTVWRWVHVAVKRNVKQLNLCVCTKEKTEAIELPHCLVSCGSLEVLRFSGLSNCGLIFPKVMGFPGLRVLQLTYVDLLEDDDLVTRILESCPLLEDLSFEDCVLCKLDRLCISCPKLKRLSIINWEDVGCHGIEISCPKLVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003210`
TK1151 ID	TkA01G385620
OH-1004 ID	LXL04_003210
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	90.000
Protein coverage (%)	TK1151 99.762 / OH-1004 49.646 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003210

Location Chr01:70945143-70951125 (+)

Description Similar to At5g56560: Putative FBD-associated F-box protein At5g56560

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56560`	Putative FBD-associated F-box protein At5g56560.	No verified direct reference in this release
`At1g69630`	F-box/LRR-repeat protein 13.	No verified direct reference in this release
`At2g26860`	FBD-associated F-box protein At2g26860.	No verified direct reference in this release
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release
`At1g78750`	F-box/FBD/LRR-repeat protein At1g78750.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003210 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G69630

ath:AT2G26860

ath:AT5G56560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.541

Rank 1 · LXL04_003210 · OH-1004

Nucleus0.532

Rank 2 · LXL04_003210 · OH-1004

Endoplasmic reticulum0.061

Rank 3 · LXL04_003210 · OH-1004

Cell membrane0.055

Rank 4 · LXL04_003210 · OH-1004

Mitochondrion0.026

Rank 5 · LXL04_003210 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box31-67 aa

PF23622.2LRR_At1g61320_AtMIF1101-380 aa

PF24758.2LRR_At5g56370123-261 aa

PF00646.39F-box473-512 aa

PF23622.2LRR_At1g61320_AtMIF1543-725 aa

PF24758.2LRR_At5g56370565-681 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003210	`PF00646.39`	F-box	31	67	3.4e-10	40.1
LXL04_003210	`PF23622.2`	LRR_At1g61320_AtMIF1	101	380	4.1e-27	96.3
LXL04_003210	`PF24758.2`	LRR_At5g56370	123	261	1e-29	104.6
LXL04_003210	`PF00646.39`	F-box	473	512	3.4e-10	40.1
LXL04_003210	`PF23622.2`	LRR_At1g61320_AtMIF1	543	725	4.1e-27	96.3
LXL04_003210	`PF24758.2`	LRR_At5g56370	565	681	1e-29	104.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJV2`	Arabidopsis thaliana	Putative FBD-associated F-box protein At5g56560	29.082%	Swiss-Prot	weak database homology
`Q9FWZ1`	Arabidopsis thaliana	F-box/LRR-repeat protein 13	29.123%	Swiss-Prot	weak database homology
`Q84X02`	Arabidopsis thaliana	FBD-associated F-box protein At2g26860	28.389%	Swiss-Prot	weak database homology
`Q9FM89`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At5g56420	30.000%	Swiss-Prot	weak database homology
`Q9ZV93`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At1g78750	26.216%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card