TkA01G382990 | RubberDandelionOmics

Gene overview

TkA01G382990

Reference: TK1151 Chr: Chr01 Coordinates: 95621907-95626222 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2482 bp · TkA01G382990|TK1151|cDNA

TCCAGGTTCGAACCTGACCAATGTATTTTTTTTTCGAAGAATCAGACTGCTTCTACGAGTTTTCAAGTTAAACTTCTAACATTAAACTCCTCGGTTCCACATACAAGGGTTTTTCTCCCTCACCGGCACCGCCACACTCCACTTCGTAAGTCAAAGATCAAATTAATTGTTGTATTGCTGATCAATCATGGGTCAAGAAGATGGTCATATACTGCATATCACAGAATACATGGTGGCGGGAGAAGAAATTATAGACAACA...

CDS

Download CDS FASTA

2295 bp · TkA01G382990|TK1151|CDS

ATGGGTCAAGAAGATGGTCATATACTGCATATCACAGAATACATGGTGGCGGGAGAAGAAATTATAGACAACAAACTCCCACAATACAAAAGAAACAATTTATCGGCATGCCTGAACATTCCTAGCCGTAAGAGAGGCATGGGATATGAAGAACTGGTGAAATTCATTCTAGGACACCCTCTGTCTACTGCGTTCACTGAAGGTACATATGTCATCCCTCAAGTTCTGTTAGAATTTTGGTACACCTGTAGAGTAGAGGG...

Protein

Download Protein FASTA

765 aa · TkA01G382990|TK1151|PROTEIN

MGQEDGHILHITEYMVAGEEIIDNKLPQYKRNNLSACLNIPSRKRGMGYEELVKFILGHPLSTAFTEGTYVIPQVLLEFWYTCRVEGSAGDIFIRTVNDGENTVRITLENLRKILRLPILPKYDLEVSKSQARSVLLEIGFPTAVGVIEKSQFTTKWGFLVSTIVRSQGTKIGSLGSVNEVEMQLLYALVKGRNLDFAQVFFNELKNHVCKKPRDPAAPYSRFVSMCIQDSIGDLYHSLAEMFQTVDTPKLDYKMFNGNI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G382990`
TK1151 ID	TkA01G382990
OH-1004 ID	LXL04_003241
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	75.100
Protein coverage (%)	TK1151 100.000 / OH-1004 93.596 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G382990

Location Chr01:95621907-95626222 (+)

Description Similar to JMJ25: Lysine-specific demethylase JMJ25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11950`	May function as histone H3 lysine demethylase and be involved in regulation of gene expression.	No verified direct reference in this release
`At1g62310`	May function as histone H3 lysine demethylase and be involved in regulation of gene expression.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003241 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009555 pollen development Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009908 flower development Biological Process

GO:0010440 stomatal lineage progression Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0031507 heterochromatin formation Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0042742 defense response to bacterium Biological Process

KEGG gene cross-reference

ath:AT1G09060

ath:AT1G11950

ath:AT1G62310

ath:AT3G07610

ath:AT4G00990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.877

Rank 1 · TkA01G382990 · TK1151

Cytoplasm0.196

Rank 2 · TkA01G382990 · TK1151

Cell membrane0.031

Rank 3 · TkA01G382990 · TK1151

Mitochondrion0.025

Rank 4 · TkA01G382990 · TK1151

Endoplasmic reticulum0.017

Rank 5 · TkA01G382990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11123DNA_Packaging_2385-435 aa

PF19761DUF6248498-545 aa

PF19761DUF6248635-684 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G382990	`PF11123`	DNA_Packaging_2	385	435	0.22	12.4
TkA01G382990	`PF19761`	DUF6248	498	545	0.26	11.8
TkA01G382990	`PF19761`	DUF6248	635	684	0.26	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0SUU8`	Arabidopsis thaliana	sp\|C0SUU8\|JMJ26_ARATH Lysine-specific demethylase JMJ26	33.700%	Swiss-Prot	Low
`C0SV12`	Arabidopsis thaliana	sp\|C0SV12\|JMJ29_ARATH Lysine-specific demethylase JMJ29	32.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card