TkA01G382750 | RubberDandelionOmics

Gene overview

TkA01G382750

Reference: TK1151 Chr: Chr01 Coordinates: 95538158-95541428 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1420 bp · TkA01G382750|TK1151|cDNA

TCCTCTACGAGTCGCGAGTGACCTGAAATCAGAATACCCTTCCTGTTCGTTTCTTTCGGCAATCTGTGCCCTGGAATCAGAATACGCCGACGACCGACGTCGACTTCCGGCCTGTGCTTGCGACTTCCGACTGTGACTGCGACGTCGACTTCCGGCGGTGTACTTATCCTCTTCGACGCCGACCAGGACCAGCACTCCAGCAGTTGACACGCAATGGCTTGGTATGAAGATGTCGAGGAAACTCGCCTTCTTGTTTCGTC...

CDS

Download CDS FASTA

846 bp · TkA01G382750|TK1151|CDS

ATGGCTTGGTATGAAGATGTCGAGGAAACTCGCCTTCTTGTTTCGTCATCAGATCCTTCTGCCACCAGAGAAGACATGGGACAGTTGCTGCAACTTCGCCATCCAAAAACTGGAGAATCTACATGCTACCTGCTGATTAATGGATGCCTTCAAGAAATCAACTGGTTTAAACAATCTTATGGGTCTTGGTTCATGGGAGATTATATTAGTGAAGATGGTAGATTATATGCTGCTACTCCAGTTGACCCTGTTTTCATTTT...

Protein

Download Protein FASTA

281 aa · TkA01G382750|TK1151|PROTEIN

MAWYEDVEETRLLVSSSDPSATREDMGQLLQLRHPKTGESTCYLLINGCLQEINWFKQSYGSWFMGDYISEDGRLYAATPVDPVFIFLPMFDKARMKNGNDPGKFRQLDEIIYHNDYPGYHHLSSIAEKSMEVVCDFKEVGSIKFFRLNDSKVLTWMYCKVQQLKESLLKLDKNYAAQSQKDTLIDAVMILGEYLQDDPWLKLLSNNLKLNIDEAVKVEGPKTEILSSSAPTSQSSFKPKQEQIGMEKRVTRNGKQNKKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G382750`
TK1151 ID	TkA01G382750
OH-1004 ID	LXL04_003245
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G382750`
Location	Chr01:95538158-95541428 (-)
Description	Similar to rnaseh2b: Ribonuclease H2 subunit B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_003245` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006298 mismatch repair Biological Process GO:0006401 RNA catabolic process Biological Process GO:0009259 ribonucleotide metabolic process Biological Process GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process GO:0010629 negative regulation of gene expression Biological Process GO:0048146 positive regulation of fibroblast proliferation Biological Process GO:1903469 removal of RNA primer involved in mitotic DNA replication Biological Process GO:2000001 regulation of DNA damage checkpoint Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0032299 ribonuclease H2 complex Cellular Component
KEGG gene cross-reference	mmu:67153 rno:361056 xla:496343 xtr:549083 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.903

Rank 1 · TkA01G382750 · TK1151

Cytoplasm0.186

Rank 2 · TkA01G382750 · TK1151

Mitochondrion0.022

Rank 3 · TkA01G382750 · TK1151

Cell membrane0.022

Rank 4 · TkA01G382750 · TK1151

Endoplasmic reticulum0.013

Rank 5 · TkA01G382750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17745Ydr279_N28-82 aa

PF09468RNase_H2-Ydr27985-168 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G382750	`PF17745`	Ydr279_N	28	82	9.7e-10	39.3
TkA01G382750	`PF09468`	RNase_H2-Ydr279	85	168	3.1e-10	41.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card