Gene Card
Gene overview
cDNA / CDS / Protein Sequences
846 bp · LXL04_003245|LXL04_003245|OH1004|cDNA
ATGGCTTGGTATGAAGATGTCGAGGAAACTCGCCTTCTTGTTTCGTCATCAGATCCTTCTGCCACCAGAGAAGACATGGGACAGTTGCTGCAACTTCGCCATCCAAAAACTGGAGAATCTACATGCTACCTGCTGATTAATGGATGCCTTCAAGAAATCAACTGGTTTAAACAATCTTATGGGTCTTGGTTCATGGGAGATTATATTAGTGAAGATGGTAGATTATATGCTGCTACTCCAGTTGACCCTGTTTTCATTCT...
846 bp · LXL04_003245|LXL04_003245|OH1004|CDS
ATGGCTTGGTATGAAGATGTCGAGGAAACTCGCCTTCTTGTTTCGTCATCAGATCCTTCTGCCACCAGAGAAGACATGGGACAGTTGCTGCAACTTCGCCATCCAAAAACTGGAGAATCTACATGCTACCTGCTGATTAATGGATGCCTTCAAGAAATCAACTGGTTTAAACAATCTTATGGGTCTTGGTTCATGGGAGATTATATTAGTGAAGATGGTAGATTATATGCTGCTACTCCAGTTGACCCTGTTTTCATTCT...
Protein
Download Protein FASTA281 aa · LXL04_003245|LXL04_003245|OH1004|PROTEIN
MAWYEDVEETRLLVSSSDPSATREDMGQLLQLRHPKTGESTCYLLINGCLQEINWFKQSYGSWFMGDYISEDGRLYAATPVDPVFILLPIFDKARMKNGSDPGKFRQLDEIIYHNDYPGYHHLSSIAEKSMEVVCDFKEVGSIKFFRLNDSKVLTWMYCKVQQLKETLLKLDKNYAAQSQKDTLIDAVMILGEYLQDDPWLKLLSNNLKLNIDEAVKVEGPKTEILSSSAPTSQSSFKPKQEQIGMEKRVTRNGKQNKKI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_003245 |
|---|---|
| TK1151 ID | TkA01G382750 |
| OH-1004 ID | LXL04_003245 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 98.600 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_003245 |
|---|---|
| Location | Chr01:71759487-71761822 (+) |
| Description | Similar to rnaseh2b: Ribonuclease H2 subunit B |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006298 mismatch repair Biological Process GO:0006401 RNA catabolic process Biological Process GO:0009259 ribonucleotide metabolic process Biological Process GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process GO:0010629 negative regulation of gene expression Biological Process GO:0048146 positive regulation of fibroblast proliferation Biological Process GO:1903469 removal of RNA primer involved in mitotic DNA replication Biological Process GO:2000001 regulation of DNA damage checkpoint Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0032299 ribonuclease H2 complex Cellular Component |
| KEGG gene cross-reference | mmu:67153 rno:361056 xla:496343 xtr:549083 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF17745.7Ydr279_N28-82 aaPF09468.17RNase_H2-Ydr27985-168 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_003245 | PF17745.7 | Ydr279_N | 28 | 82 | 9.8e-10 | 39.3 |
| LXL04_003245 | PF09468.17 | RNase_H2-Ydr279 | 85 | 168 | 4.8e-11 | 44.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.