TkA01G379000 | RubberDandelionOmics

Gene overview

TkA01G379000

Reference: TK1151 Chr: Chr01 Coordinates: 94719936-94723610 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2893 bp · TkA01G379000|TK1151|cDNA

GCCGTCTCTCTCATTTGGCAAACAACGGCGCGGACAAATCTTAAACCAAAACACCTATTTCTCTCTCTCGAAAAGCCCGTTTCCCCCAAAGGCACACAAGTTTTGAAATTTCAGTACACAAAAGGAAATAAATAGGGGGGAGACCGAAGAAGGTGAAACAACCGAGAAACCTACCTATAAAGTTTCCTTATATCTATTTTGCAGAACTTGTGTGTATAGATTCAAACTGGTTTTGTTTATCTGCTTCAAAAGAGTGGATC...

CDS

Download CDS FASTA

2115 bp · TkA01G379000|TK1151|CDS

ATGTGGAAAACATTAGCATCTCTCGGGTTGATTTCGTTGCTTCTGGTCTGCGTTCTCGCCACCGATGACGGGTCTGAAAACGGATTCGGTGGGTGTAATTGCGAAGTCGAAGGGTTCTTCGGGTACAGAAACATCATGGAAACGCAAAGAGTAAGCGATTTTTTAATCGCGGTCGCTTATTTCTCAATTCCAATCGAGCTTCTTTACTTCGTAAGCTGTTCAAATGTTCCTTTCAAATGGGTCCTCTTCCAGTTCATCGC...

Protein

Download Protein FASTA

704 aa · TkA01G379000|TK1151|PROTEIN

MWKTLASLGLISLLLVCVLATDDGSENGFGGCNCEVEGFFGYRNIMETQRVSDFLIAVAYFSIPIELLYFVSCSNVPFKWVLFQFIAFIVLCGMTHLLNGWTYEPHPFQLMLALTIFKFLTALVSFATAITLVTLIPLLLKVKVREFMLKKKTWDLGVEMGMIKKQKEAGWHVRMLTQEIRKSLDRHTILYTTLDKLSETLDLQNCAIWMPDNAKTVMNLTHQLKGGQSSTVIPIQDSDVQEIKQSEVVKLLDQESQLAT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G379000`
TK1151 ID	TkA01G379000
OH-1004 ID	LXL04_022975
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.900
Protein coverage (%)	TK1151 99.858 / OH-1004 93.455 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G379000

Location Chr01:94719936-94723610 (-)

Description Similar to ETR2: Ethylene receptor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23150`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`At3g04580`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0820900`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`Os04g0169100`	Ethylene receptor related to bacterial two-component regulators.	The ethylene receptor ETR2 delays floral transition and affects starch accumulation in rice.2009 · DOI: 10.1105/tpc.108.065391
`UniProt: Q6T5K2`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022975 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009723 response to ethylene Biological Process

GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:2000904 regulation of starch metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0000155 phosphorelay sensor kinase activity Molecular Function

GO:0004673 protein histidine kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G04580

ath:AT3G23150

dosa:Os02g0820900

dosa:Os04g0169100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.374

Rank 1 · TkA01G379000 · TK1151

Cell membrane0.240

Rank 2 · TkA01G379000 · TK1151

Golgi apparatus0.239

Rank 3 · TkA01G379000 · TK1151

Cytoplasm0.120

Rank 4 · TkA01G379000 · TK1151

Nucleus0.101

Rank 5 · TkA01G379000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25487ETR1_N45-142 aa

PF01590GAF185-331 aa

PF13492GAF_3189-241 aa

PF13492GAF_3301-333 aa

PF00072Response_reg322-360 aa

PF00512HisKA333-365 aa

PF24896Receiver_CRE1362-383 aa

PF00512HisKA367-430 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G379000	`PF25487`	ETR1_N	45	142	5.7e-42	143.1
TkA01G379000	`PF01590`	GAF	185	331	1.3e-10	42.6
TkA01G379000	`PF13492`	GAF_3	189	241	0.019	16.1
TkA01G379000	`PF13492`	GAF_3	301	333	0.019	16.1
TkA01G379000	`PF00072`	Response_reg	322	360	9.7e-11	42.5
TkA01G379000	`PF00512`	HisKA	333	365	4.6e-07	30.5
TkA01G379000	`PF24896`	Receiver_CRE1	362	383	0.027	15.4
TkA01G379000	`PF00512`	HisKA	367	430	4.6e-07	30.5
TkA01G379000	`PF02518`	HATPase_c	477	581	0.017	16.3
TkA01G379000	`PF01590`	GAF	569	601	1.3e-10	42.6
TkA01G379000	`PF24896`	Receiver_CRE1	619	665	0.027	15.4
TkA01G379000	`PF00072`	Response_reg	626	702	9.7e-11	42.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WPQ2`	Arabidopsis thaliana	sp\|Q0WPQ2\|ETR2_ARATH Ethylene receptor 2	58.400%	Swiss-Prot	High
`Q9ZTP3`	Arabidopsis thaliana	sp\|Q9ZTP3\|EIN4_ARATH Protein EIN4	54.300%	Swiss-Prot	High
`Q0DWC7`	Oryza sativa subsp. japonica	sp\|Q0DWC7\|ETR3_ORYSJ Ethylene receptor 3	51.300%	Swiss-Prot	High
`Q7XX84`	Oryza sativa subsp. japonica	sp\|Q7XX84\|ETR2_ORYSJ Ethylene receptor 2	50.900%	Swiss-Prot	High
`Q6T5K2`	Oryza sativa subsp. indica	sp\|Q6T5K2\|ETR3_ORYSI Ethylene receptor 3	51.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card