LXL04_022975 | RubberDandelionOmics

Gene overview

LXL04_022975

Reference: OH-1004 Chr: Chr05 Coordinates: 16180388-16182772 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2295 bp · LXL04_022975|LXL04_022975|OH1004|cDNA

ATGAACCTAATGTCGACAAATTTAGCAAATTTCACGTTAATTTTCCTGTTCTTGATCTCTGTTTCGGCATCCGATAATGGATTCTCAGGCTGTAACTGCGAGGATGAAGGTTTCTTCGGGTACAGAAACATCATGGAAACACAAAGAGTGAGTGATTTCTTAATCGCAGTTGCTTACTTCTCGATTCCAATCGAGCTTCTATACTTCGTAAGCTGTTCAAACGTCCCTTTCAAATGGGTTCTCTTCCAATTCATTTTATT...

CDS

Download CDS FASTA

2295 bp · LXL04_022975|LXL04_022975|OH1004|CDS

ATGAACCTAATGTCGACAAATTTAGCAAATTTCACGTTAATTTTCCTGTTCTTGATCTCTGTTTCGGCATCCGATAATGGATTCTCAGGCTGTAACTGCGAGGATGAAGGTTTCTTCGGGTACAGAAACATCATGGAAACACAAAGAGTGAGTGATTTCTTAATCGCAGTTGCTTACTTCTCGATTCCAATCGAGCTTCTATACTTCGTAAGCTGTTCAAACGTCCCTTTCAAATGGGTTCTCTTCCAATTCATTTTATT...

Protein

Download Protein FASTA

764 aa · LXL04_022975|LXL04_022975|OH1004|PROTEIN

MNLMSTNLANFTLIFLFLISVSASDNGFSGCNCEDEGFFGYRNIMETQRVSDFLIAVAYFSIPIELLYFVSCSNVPFKWVLFQFILFIVLCGMTHLLNGWTYAAHPFQLMLALTIFKFLTALVSFATAITLITLIPLLLKVKVREFMLKKKFWDLGREMGMIKKQKEAGWHVRMLTHEIRKSLDRHTILYTTLDKLSKTLDLQNCAIWMPDKAKTVMNLTHQLKGIQENLRIDNFYIPINDSDVQEIKRSEVVKLLDRES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022975`
TK1151 ID	TkA01G379000
OH-1004 ID	LXL04_022975
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.900
Protein coverage (%)	TK1151 99.858 / OH-1004 93.455 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022975

Location Chr05:16180388-16182772 (+)

Description Similar to ETR2: Ethylene receptor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23150`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`At3g04580`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0169100`	Ethylene receptor related to bacterial two-component regulators.	The ethylene receptor ETR2 delays floral transition and affects starch accumulation in rice.2009 · DOI: 10.1105/tpc.108.065391
`UniProt: Q8H1X1`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`Os02g0820900`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022975 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009723 response to ethylene Biological Process

GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:2000904 regulation of starch metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0000155 phosphorelay sensor kinase activity Molecular Function

GO:0004673 protein histidine kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G04580

ath:AT3G23150

dosa:Os02g0820900

dosa:Os04g0169100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.379

Rank 1 · LXL04_022975 · OH-1004

Golgi apparatus0.202

Rank 2 · LXL04_022975 · OH-1004

Cell membrane0.198

Rank 3 · LXL04_022975 · OH-1004

Cytoplasm0.164

Rank 4 · LXL04_022975 · OH-1004

Nucleus0.137

Rank 5 · LXL04_022975 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25487.2ETR1_N44-141 aa

PF01590.33GAF184-335 aa

PF00512.32HisKA371-436 aa

PF00072.31Response_reg640-750 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022975	`PF25487.2`	ETR1_N	44	141	2e-40	138.2
LXL04_022975	`PF01590.33`	GAF	184	335	3.5e-11	44.5
LXL04_022975	`PF00512.32`	HisKA	371	436	4.1e-09	37.1
LXL04_022975	`PF00072.31`	Response_reg	640	750	7.4e-19	68.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WPQ2`	Arabidopsis thaliana	Ethylene receptor 2	56.781%	Swiss-Prot	strong database homology
`Q9ZTP3`	Arabidopsis thaliana	Protein EIN4	56.117%	Swiss-Prot	strong database homology
`Q7XX84`	Oryza sativa subsp. japonica	Ethylene receptor 2	52.000%	Swiss-Prot	strong database homology
`Q8H1X1`	Oryza sativa subsp. indica	Ethylene receptor 2	51.862%	Swiss-Prot	strong database homology
`Q0DWC7`	Oryza sativa subsp. japonica	Ethylene receptor 3	49.465%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card