TkA01G372340 | RubberDandelionOmics

Gene overview

TkA01G372340

Reference: TK1151 Chr: Chr01 Coordinates: 92883475-92886023 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · TkA01G372340|TK1151|cDNA

ATGGCTGCGATCATGATGAACGAGACTTTGCTTGAGTCCTCGACATGCTTGCGGTTAGCCGCAATTTATTCATCAGTAGAGAAATCATCAATGGGAGTAATTGGGTTATCAAGGATACCGTGGACTCATAGATACAATGGTGAATCAACCGACCAAAACCGCGTAGCTACATTGGATCATGGTGAACGACATCGTATATTGATAAATGTCGGGCGTGCCCTTGCGAACTCGGCTGAAGATATTTTGAAAATTATCAAAGA...

CDS

Download CDS FASTA

1068 bp · TkA01G372340|TK1151|CDS

ATGGCTGCGATCATGATGAACGAGACTTTGCTTGAGTCCTCGACATGCTTGCGGTTAGCCGCAATTTATTCATCAGTAGAGAAATCATCAATGGGAGTAATTGGGTTATCAAGGATACCGTGGACTCATAGATACAATGGTGAATCAACCGACCAAAACCGCGTAGCTACATTGGATCATGGTGAACGACATCGTATATTGATAAATGTCGGGCGTGCCCTTGCGAACTCGGCTGAAGATATTTTGAAAATTATCAAAGA...

Protein

Download Protein FASTA

355 aa · TkA01G372340|TK1151|PROTEIN

MAAIMMNETLLESSTCLRLAAIYSSVEKSSMGVIGLSRIPWTHRYNGESTDQNRVATLDHGERHRILINVGRALANSAEDILKIIKEEEQEEAEVSTRRTRRQIVRNRMAASDLLMAHYFNDDAVYGPEIFRRRFRMHQPLFLRIAAIRKLSYGSVSDSWDEYFQMSERVVRENQDEFCECVIFLYRKRFQGQFARGGNNHPTLVLEAVASQDLWIWHAFFGSPGCLNDINILDRSPLFDTFCNGSAAPCSFTLRDRQYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G372340`
TK1151 ID	TkA01G372340
OH-1004 ID	LXL04_017125
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	38.300
Protein coverage (%)	TK1151 72.113 / OH-1004 33.874 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G372340`
Location	Chr01:92883475-92886023 (+)
Description	Similar to OM64: Outer envelope protein 64, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017125` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006626 protein targeting to mitochondrion Biological Process GO:0009684 indoleacetic acid biosynthetic process Biological Process GO:0009851 auxin biosynthetic process Biological Process GO:0015031 protein transport Biological Process GO:0030150 protein import into mitochondrial matrix Biological Process GO:0005576 extracellular region Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference	ath:AT1G08980 ath:AT3G17970 ath:AT5G09420 dosa:Os04g0118100 osa:4334958 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.894

Rank 1 · TkA01G372340 · TK1151

Cytoplasm0.203

Rank 2 · TkA01G372340 · TK1151

Mitochondrion0.021

Rank 3 · TkA01G372340 · TK1151

Cell membrane0.020

Rank 4 · TkA01G372340 · TK1151

Extracellular0.015

Rank 5 · TkA01G372340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19736DUF622637-98 aa

PF28509DUF8418114-146 aa

PF04827Plant_tran190-288 aa

PF13359DDE_Tnp_4199-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G372340	`PF19736`	DUF6226	37	98	0.031	14.7
TkA01G372340	`PF28509`	DUF8418	114	146	6e-15	55.4
TkA01G372340	`PF04827`	Plant_tran	190	288	8.1e-37	127.6
TkA01G372340	`PF13359`	DDE_Tnp_4	199	260	0.16	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card