TkA01G371130 | RubberDandelionOmics

Gene overview

TkA01G371130

Reference: TK1151 Chr: Chr01 Coordinates: 92533405-92536287 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2038 bp · TkA01G371130|TK1151|cDNA

TTATGATTATGATTTGCTTTACCGTTTTTGCATAAAATTTATAATGGTATACGTAAAGGCTAACGACCTCTTTCCTTCTTATTTACCAAACACATAAACCTGTTTTCTTCAAAAACCCTATTTACGTGCGTCTCCCCCTCTTGCTTTTCACCCTGGAGACGTTCTCACATTCAGAGCAGCTAGAATACTTTCCAAGTTATGTCACTTCAACCTTCTTCCAGAACAACAATGGTGAAGATCATGTAGTGGATCAAAAGACA...

CDS

Download CDS FASTA

1311 bp · TkA01G371130|TK1151|CDS

ATGAGGAGTACAAAATTCCCTATACGTTACCTAATCGTCATATTGACCTTCTTTTGCACCTGTGTATGTTACATTGAACGTGTAGGCTTTTCAATTGCATACACAATTGCTGCAGATGATGCAGGCGTCAGTCAATCAAGCAAAGGCACCATTCTGTCAACATTCTATTACGGGTACGCTTTTTCTCAGGTCCCTGGTGGTTGGGCAGCACAAAAGATCGGGGGCAGACGTATTCTCCTTTTTTCATTTGTGATTTGGTC...

Protein

Download Protein FASTA

436 aa · TkA01G371130|TK1151|PROTEIN

MRSTKFPIRYLIVILTFFCTCVCYIERVGFSIAYTIAADDAGVSQSSKGTILSTFYYGYAFSQVPGGWAAQKIGGRRILLFSFVIWSLTCALCPLDPKRVMALVIARLLVGVAQGFIFPSIHTVLAQWVPPHERSRSLSLTTSGMYLGAALGMLFLPSLVKFKGPQSVFLAESALGGLWSLLWLQFASDPPRVDHPKATAAGFGEYLLPIRDSQTLKPDKTSQIPWRRIFLSLPVWAILVNNFTFHYALYVLMNWLPTYF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G371130`
TK1151 ID	TkA01G371130
OH-1004 ID	LXL04_003344
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 93.578 / OH-1004 24.446 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G371130

Location Chr01:92533405-92536287 (+)

Description Similar to ANTR5: Probable anion transporter 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44370`	Inorganic phosphate and probable anion transporter.	No verified direct reference in this release
`At4g00370`	Inorganic phosphate and probable anion transporter.	AtPHT4;4 is a chloroplast-localized ascorbate transporter in Arabidopsis.2015 · DOI: 10.1038/ncomms6928

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0180100`	Probable anion transporter.	No verified direct reference in this release
`Os11g0186800`	Probable anion transporter.	No verified direct reference in this release
`Os09g0570400`	Probable anion transporter.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003344 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006811 monoatomic ion transport Biological Process

GO:0009624 response to nematode Biological Process

GO:0000118 histone deacetylase complex Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0048188 Set1C/COMPASS complex Cellular Component

GO:0003712 transcription coregulator activity Molecular Function

GO:0005315 phosphate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G11950

ath:AT5G44370

dosa:Os11g0186800

dosa:Os12g0180100

osa:4349969

osa:4351670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.272

Rank 1 · TkA01G371130 · TK1151

Golgi apparatus0.195

Rank 2 · TkA01G371130 · TK1151

Endoplasmic reticulum0.183

Rank 3 · TkA01G371130 · TK1151

Cytoplasm0.179

Rank 4 · TkA01G371130 · TK1151

Cell membrane0.130

Rank 5 · TkA01G371130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07690MFS_117-383 aa

PF00083Sugar_tr44-182 aa

PF00083Sugar_tr364-388 aa

PF07690MFS_1406-428 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G371130	`PF07690`	MFS_1	17	383	1.3e-52	179.6
TkA01G371130	`PF00083`	Sugar_tr	44	182	4e-07	30.0
TkA01G371130	`PF00083`	Sugar_tr	364	388	4e-07	30.0
TkA01G371130	`PF07690`	MFS_1	406	428	1.3e-52	179.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FKV1`	Arabidopsis thaliana	sp\|Q9FKV1\|ANTR5_ARATH Probable anion transporter 5	75.900%	Swiss-Prot	High
`Q8GX78`	Arabidopsis thaliana	sp\|Q8GX78\|ANTR2_ARATH Ascorbate transporter, chloroplastic	37.600%	Swiss-Prot	Medium
`Q2QWW7`	Oryza sativa subsp. japonica	sp\|Q2QWW7\|PHT47_ORYSJ Probable anion transporter 7	70.200%	Swiss-Prot	High
`Q53P54`	Oryza sativa subsp. japonica	sp\|Q53P54\|PHT46_ORYSJ Probable anion transporter 6	71.500%	Swiss-Prot	High
`Q652N5`	Oryza sativa subsp. japonica	sp\|Q652N5\|PHT44_ORYSJ Probable anion transporter 4, chloroplastic	38.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card