TkA01G363380 | RubberDandelionOmics

Gene overview

TkA01G363380

Reference: TK1151 Chr: Chr01 Coordinates: 90450034-90453972 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1134 bp · TkA01G363380|TK1151|cDNA

TGGCATTCCATTTTTCAGATATCATCTACACCTCCTGAACCTGAACTTGAACCTGAATGTGTTCCTCGTGTGGATGTTGACAAGGTTCGATGGGTCATCAGGAACTTTATCAGAGACTGGGCTACTGAGGGGCAGAAGGAACGAGATGAGTGTTTTGGGCCTATTCTTGAAGAGCTTAAACGCAATTTCCCTGACCGAAGTAAAGAAAGCCCTCCTACTTGTCTGGTTCCAGGCGCTGGATTAGGAAGACTGGCCTTGGA...

CDS

Download CDS FASTA

885 bp · TkA01G363380|TK1151|CDS

TGGCATTCCATTTTTCAGATATCATCTACACCTCCTGAACCTGAACTTGAACCTGAATGTGTTCCTCGTGTGGATGTTGACAAGGTTCGATGGGTCATCAGGAACTTTATCAGAGACTGGGCTACTGAGGGGCAGAAGGAACGAGATGAGTGTTTTGGGCCTATTCTTGAAGAGCTTAAACGCAATTTCCCTGACCGAAGTAAAGAAAGCCCTCCTACTTGTCTGGTTCCAGGCGCTGGATTAGGAAGACTGGCCTTGGA...

Protein

Download Protein FASTA

294 aa · TkA01G363380|TK1151|PROTEIN

WHSIFQISSTPPEPELEPECVPRVDVDKVRWVIRNFIRDWATEGQKERDECFGPILEELKRNFPDRSKESPPTCLVPGAGLGRLALEISCLGFISQGNEFSYYMMICSSFILNQCEVVGEWSIHPWIHSNCNSLSDADQLRPVSIPDIHPASAGITEGFSMCGGDFVEVYGDPTQVGSWDSVVTCFFLDTAHNIVEYIKIISKILKDGGVWINLGPLLYHFADMYEQDEMSVELSLEDVKKVAFNYGFQLEVEKTIETTY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G363380`
TK1151 ID	TkA01G363380
OH-1004 ID	LXL04_003411
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.959 / OH-1004 61.017 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G363380`
Location	Chr01:90450034-90453972 (+)
Description	Similar to Carnmt1: Carnosine N-methyltransferase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_003411` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006548 L-histidine catabolic process Biological Process GO:0032259 methylation Biological Process GO:0034198 cellular response to amino acid starvation Biological Process GO:0035498 carnosine metabolic process Biological Process GO:0061431 cellular response to methionine Biological Process GO:1904262 negative regulation of TORC1 signaling Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function GO:0030735 carnosine N-methyltransferase activity Molecular Function GO:0042803 protein homodimerization activity Molecular Function GO:0044877 protein-containing complex binding Molecular Function
KEGG gene cross-reference	dme:Dmel_CG11596 gga:427256 hsa:138199 mmu:67383 rno:293871 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.612

Rank 1 · TkA01G363380 · TK1151

Nucleus0.499

Rank 2 · TkA01G363380 · TK1151

Mitochondrion0.062

Rank 3 · TkA01G363380 · TK1151

Cell membrane0.057

Rank 4 · TkA01G363380 · TK1151

Endoplasmic reticulum0.055

Rank 5 · TkA01G363380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07942CARME19-282 aa

PF22478DUF698222-48 aa

PF08242Methyltransf_12172-210 aa

PF01234NNMT_PNMT_TEMT178-262 aa

PF22478DUF6982224-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G363380	`PF07942`	CARME	19	282	5.6e-109	364.3
TkA01G363380	`PF22478`	DUF6982	22	48	0.12	13.1
TkA01G363380	`PF08242`	Methyltransf_12	172	210	0.11	14.0
TkA01G363380	`PF01234`	NNMT_PNMT_TEMT	178	262	0.23	11.3
TkA01G363380	`PF22478`	DUF6982	224	267	0.12	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card