Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1419 bp · LXL04_003411|LXL04_003411|OH1004|cDNA
ATGTTTTCCTCGCCGCTAAACTGCTTAGTGGTCCATCAAACTCGGAAAAACAATATGTCGAACAGCGACGAGGAACTCCGCCGGAGGAAGTACGAAGCCCTAGAAGCCAAATCTCTTAGGCGCATCATCGCCGCCTACTTCAATTATCCAGAAGCTGCAGAGGATGATGTGAAAAGATACGAGAGATCTTTCAGAAGGCTTCCAGTGGCTCACAAGGTGCCGTTTATTTATGCTATGCTGGCACATCTTCCTTTAAAATA...
1419 bp · LXL04_003411|LXL04_003411|OH1004|CDS
ATGTTTTCCTCGCCGCTAAACTGCTTAGTGGTCCATCAAACTCGGAAAAACAATATGTCGAACAGCGACGAGGAACTCCGCCGGAGGAAGTACGAAGCCCTAGAAGCCAAATCTCTTAGGCGCATCATCGCCGCCTACTTCAATTATCCAGAAGCTGCAGAGGATGATGTGAAAAGATACGAGAGATCTTTCAGAAGGCTTCCAGTGGCTCACAAGGTGCCGTTTATTTATGCTATGCTGGCACATCTTCCTTTAAAATA...
Protein
Download Protein FASTA472 aa · LXL04_003411|LXL04_003411|OH1004|PROTEIN
MFSSPLNCLVVHQTRKNNMSNSDEELRRRKYEALEAKSLRRIIAAYFNYPEAAEDDVKRYERSFRRLPVAHKVPFIYAMLAHLPLKYQKLRRCIDKNTFFIFEMLKAFEPPVDMSQEDENCEHLEDGSCGHFHSGDKDPCACESASVSGRPHSTKSGEVCETHKDTSDNITDVKDPKSLDTATDISSTPPEPELEPECVPRVDVDKVRWVIRNFIRDWATEGQKERDECFGPILEELKRNFPDRSKESPPTCLVPGAGLG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_003411 |
|---|---|
| TK1151 ID | TkA01G363380 |
| OH-1004 ID | LXL04_003411 |
| Relationship / confidence | Multi Candidate From Tk1151 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 97.959 / OH-1004 61.017Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_003411 |
|---|---|
| Location | Chr01:77784782-77791828 (-) |
| Description | Similar to Carnmt1: Carnosine N-methyltransferase |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006548 L-histidine catabolic process Biological Process GO:0032259 methylation Biological Process GO:0034198 cellular response to amino acid starvation Biological Process GO:0035498 carnosine metabolic process Biological Process GO:0061431 cellular response to methionine Biological Process GO:1904262 negative regulation of TORC1 signaling Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function GO:0030735 carnosine N-methyltransferase activity Molecular Function GO:0042803 protein homodimerization activity Molecular Function GO:0044877 protein-containing complex binding Molecular Function |
| KEGG gene cross-reference | dme:Dmel_CG11596 gga:427256 hsa:138199 mmu:67383 rno:293871 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07942.19CARME197-460 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_003411 | PF07942.19 | CARME | 197 | 460 | 2.2e-108 | 362.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.