TkA01G349490 | RubberDandelionOmics

Gene overview

TkA01G349490

Reference: TK1151 Chr: Chr01 Coordinates: 86774712-86780450 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2253 bp · TkA01G349490|TK1151|cDNA

ACGGGGCATTATTTTGACTTTTCCAACTCCTTTTGAAAAACTCACGCTTCACAGTCGCTGCTTCTCTTCACTCGAACGCCCTATTTGCCCCCTGAAATCTCCATCTACCTCCATTTTAATCGCCCTCTGAAATCACCATCTGTGAATCGAATCTACCTCCATTAATCGCCCTCTGTGAAATCGATGTCTCCATCTCCATAAATCAATGGCTTCTCCTTCTTTCCCCAACTACCAGCCGACGATCTCCATAAATCAATGGC...

CDS

Download CDS FASTA

2607 bp · TkA01G349490|TK1151|CDS

ATGCACATGGGTTACTCCGATCACCGCCGTTACCCTGATTTCTCTCTCATTTCACAATCCGGCGACTTCAATGCCGCCGTTTCATGCATCATTATCACTCACTTTCACTTGGATCATATTGGTGCTCTTCCGTACTTCACTGAAGTTTGTGGTTACACCGGTCCGATTTACATGACGTATCCAACCAAAGCCTTGGCTCCACTTATGTTAGAAGATTACCGAAAAGTAATGGTGGGAAGGGGAGAAGAGCAACAGTTCAC...

Protein

Download Protein FASTA

868 aa · TkA01G349490|TK1151|PROTEIN

MHMGYSDHRRYPDFSLISQSGDFNAAVSCIIITHFHLDHIGALPYFTEVCGYTGPIYMTYPTKALAPLMLEDYRKVMVGRGEEQQFTHENILDCMKKVTAVDLKQNVQVDKDLQIRAYYAGHVLGAAMFYACVEGSGIVYTGDYNMTPDRHLGAAQIDRLQLDLLITESTYATTIRDSKYAREREFLKAVHKCVANGGKVLIPTFALGRAQELCILLDDYWERMNLKVPIYFSAGLTIQANLYYKVLINWTSQKVKDTYA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G349490`
TK1151 ID	TkA01G349490
OH-1004 ID	LXL04_003496
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 97.235 / OH-1004 67.144 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G349490

Location Chr01:86774712-86780450 (+)

Description Similar to CPSF73-II: Cleavage and polyadenylation specificity factor subunit 3-II

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g01730`	Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition.	Unique features of plant cleavage and polyadenylation specificity factor revealed by proteomic studies.2009 · DOI: 10.1104/pp.109.142729
`At2g01735`	Probable E3 ubiquitin-protein ligase required for embryo development.	A RING-H2 zinc-finger protein gene RIE1 is essential for seed development in Arabidopsis.2003 · DOI: 10.1023/b:plan.0000009256.01620.a6
`At4g11680`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At1g12760`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At1g63170`	Mediates E2-dependent protein ubiquitination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003496 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0016180 snRNA processing Biological Process

GO:0034472 snRNA 3'-end processing Biological Process

GO:0160240 RNA polymerase II transcription initiation surveillance Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0032039 integrator complex Cellular Component

GO:0160232 INTAC complex Cellular Component

GO:0004521 RNA endonuclease activity Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G01730

ddi:DDB_G0278189

gga:419418

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.339

Rank 1 · TkA01G349490 · TK1151

Golgi apparatus0.215

Rank 2 · TkA01G349490 · TK1151

Cytoplasm0.177

Rank 3 · TkA01G349490 · TK1151

Nucleus0.173

Rank 4 · TkA01G349490 · TK1151

Cell membrane0.169

Rank 5 · TkA01G349490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16661Lactamase_B_624-157 aa

PF00753Lactamase_B24-150 aa

PF12706Lactamase_B_225-170 aa

PF23023Anti-Pycsar_Apyc126-150 aa

PF10996Beta-Casp210-328 aa

PF07521RMMBL344-401 aa

PF12706Lactamase_B_2358-380 aa

PF14256YwiC648-732 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G349490	`PF16661`	Lactamase_B_6	24	157	7.4e-18	65.3
TkA01G349490	`PF00753`	Lactamase_B	24	150	1.8e-07	32.0
TkA01G349490	`PF12706`	Lactamase_B_2	25	170	0.00013	22.3
TkA01G349490	`PF23023`	Anti-Pycsar_Apyc1	26	150	1.6e-06	28.8
TkA01G349490	`PF10996`	Beta-Casp	210	328	1e-26	94.6
TkA01G349490	`PF07521`	RMMBL	344	401	2.4e-16	60.2
TkA01G349490	`PF12706`	Lactamase_B_2	358	380	0.00013	22.3
TkA01G349490	`PF14256`	YwiC	648	732	1.9	9.5
TkA01G349490	`PF14256`	YwiC	772	815	1.9	9.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUU3`	Arabidopsis thaliana	sp\|Q8GUU3\|CPS3B_ARATH Cleavage and polyadenylation specificity factor subunit 3-II	64.500%	Swiss-Prot	High
`Q8GUU2`	Arabidopsis thaliana	sp\|Q8GUU2\|RIE1_ARATH E3 ubiquitin protein ligase RIE1	54.500%	Swiss-Prot	High
`Q93Z92`	Arabidopsis thaliana	sp\|Q93Z92\|RING4_ARATH E3 ubiquitin-protein ligase At4g11680	50.400%	Swiss-Prot	Medium
`Q9LN71`	Arabidopsis thaliana	sp\|Q9LN71\|RING1_ARATH E3 ubiquitin-protein ligase At1g12760	50.200%	Swiss-Prot	Medium
`Q8LDB8`	Arabidopsis thaliana	sp\|Q8LDB8\|RING2_ARATH E3 ubiquitin-protein ligase At1g63170	49.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card