TkA01G320800 | RubberDandelionOmics

Gene overview

TkA01G320800

Reference: TK1151 Chr: Chr01 Coordinates: 79641635-79642975 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1158 bp · TkA01G320800|TK1151|cDNA

ATGAAGCAAATCACAATGATGTATAATCTGGCTTTTCAAGAAGCTGAGTCAGCTATAGATAAGGCAAAAGGCATAATGAACTGGAAATTAGAGGAGGATAGTAACCTGGAAGAGGCTAGGCAATCTCAAGAGGCTGTTGAATTGGCACAGAAGGCACAACGAATAGCAGAATTAGAGTCGGAAAAGAGAAGGATTGCAGAGAGGAAGTTCCAACTGGAGTTTCAAGAGAAGCAGAAGGCCATTGATGCATTAACACATAA...

CDS

Download CDS FASTA

1158 bp · TkA01G320800|TK1151|CDS

ATGAAGCAAATCACAATGATGTATAATCTGGCTTTTCAAGAAGCTGAGTCAGCTATAGATAAGGCAAAAGGCATAATGAACTGGAAATTAGAGGAGGATAGTAACCTGGAAGAGGCTAGGCAATCTCAAGAGGCTGTTGAATTGGCACAGAAGGCACAACGAATAGCAGAATTAGAGTCGGAAAAGAGAAGGATTGCAGAGAGGAAGTTCCAACTGGAGTTTCAAGAGAAGCAGAAGGCCATTGATGCATTAACACATAA...

Protein

Download Protein FASTA

385 aa · TkA01G320800|TK1151|PROTEIN

MKQITMMYNLAFQEAESAIDKAKGIMNWKLEEDSNLEEARQSQEAVELAQKAQRIAELESEKRRIAERKFQLEFQEKQKAIDALTHNEVQYRRYTTEEIQIATNYFSGQDKIGEGGYGPVFRGTLDHTPVAIKVLRPDMSQGEKQFQREVEVLSRMRHPNMVILLGACPDYGCLVYEYMENGSLEDMLNRKNGTLTLSPQTRFRIAVEIATALNFLHRTRPEPLVHRDLKPANILLDRNNVSKISDVGLSRLVPLSVADS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G320800`
TK1151 ID	TkA01G320800
OH-1004 ID	LXL04_022120
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	59.200
Protein coverage (%)	TK1151 95.584 / OH-1004 48.684 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G320800

Location Chr01:79641635-79642975 (-)

Description Similar to PUB35: U-box domain-containing protein 35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25160`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g61560`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g61550`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At2g19410`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g51270`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022120 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19410

ath:AT4G25160

ath:AT5G61550

ath:AT5G61560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.551

Rank 1 · TkA01G320800 · TK1151

Cytoplasm0.352

Rank 2 · TkA01G320800 · TK1151

Nucleus0.226

Rank 3 · TkA01G320800 · TK1151

Golgi apparatus0.046

Rank 4 · TkA01G320800 · TK1151

Endoplasmic reticulum0.046

Rank 5 · TkA01G320800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01636APH23-64 aa

PF12330Haspin_kinase44-191 aa

PF00069Pkinase55-87 aa

PF00069Pkinase109-360 aa

PF07714PK_Tyr_Ser-Thr109-362 aa

PF03109ABC1118-142 aa

PF08756YfkB144-211 aa

PF12260PIP49_C161-247 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G320800	`PF01636`	APH	23	64	0.056	13.9
TkA01G320800	`PF12330`	Haspin_kinase	44	191	0.035	13.9
TkA01G320800	`PF00069`	Pkinase	55	87	9.5e-42	143.9
TkA01G320800	`PF00069`	Pkinase	109	360	9.5e-42	143.9
TkA01G320800	`PF07714`	PK_Tyr_Ser-Thr	109	362	7.3e-41	140.9
TkA01G320800	`PF03109`	ABC1	118	142	0.0021	18.0
TkA01G320800	`PF08756`	YfkB	144	211	0.012	16.1
TkA01G320800	`PF12260`	PIP49_C	161	247	0.0026	18.1
TkA01G320800	`PF01636`	APH	172	222	0.056	13.9
TkA01G320800	`PF03109`	ABC1	174	265	0.0021	18.0
TkA01G320800	`PF19974`	TCAD9	178	242	0.039	13.8
TkA01G320800	`PF01636`	APH	210	240	0.056	13.9
TkA01G320800	`PF12330`	Haspin_kinase	226	253	0.035	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SW11`	Arabidopsis thaliana	sp\|Q9SW11\|PUB35_ARATH U-box domain-containing protein 35	54.100%	Swiss-Prot	High
`Q9FKG5`	Arabidopsis thaliana	sp\|Q9FKG5\|PUB51_ARATH U-box domain-containing protein 51	53.500%	Swiss-Prot	High
`Q9FKG6`	Arabidopsis thaliana	sp\|Q9FKG6\|PUB52_ARATH U-box domain-containing protein 52	45.800%	Swiss-Prot	Medium
`Q8S8S7`	Arabidopsis thaliana	sp\|Q8S8S7\|PUB34_ARATH U-box domain-containing protein 34	49.700%	Swiss-Prot	Medium
`Q9LU47`	Arabidopsis thaliana	sp\|Q9LU47\|PUB53_ARATH Putative U-box domain-containing protein 53	52.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card