TkA01G221370 | RubberDandelionOmics

Gene overview

TkA01G221370

Reference: TK1151 Chr: Chr01 Coordinates: 56346895-56349082 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

995 bp · TkA01G221370|TK1151|cDNA

CGACAAAACTAAGCCTCTATCCCGGGTTCAAAACATTTCCTCGATAACTCCCTTTCCTCTGCACGCTTGCACGCCTTCTCACTATCCTCTGCACGCATGCTTCTTCGATTCCCCTTGCACGCGGATTCAGCTTGGATATCACACGGATTGCCCTCGATTCCTTCTCCACGCATGCTTCTCCGATTCCCACGCCTTCTCCGATTCCCTCTGAAGATGCGACACATCCACCTCTCCACAAAAACACCTCCATCGTGACCACT...

CDS

Download CDS FASTA

498 bp · TkA01G221370|TK1151|CDS

ATGGAGTATGGATGGAAAGTGAATGACAACATTGATTTTGATTGGAAAAAGCTACTACACAAGGAAAAAGAAAACTTCCATCAACTTGAATACTTTAGGGAAGTAAAAAACCGTTCTATGATGTCTGTCATGGGCAATTCAACAAATCTTTTCTGGCACGAAAACACAGTTGGGAAAACCGAACGCCAAAAGCTGATTAACCAACAAGGATGTGTTGTATGGATCACAGGTCTCGGTGGATCAGGAGAAGTAGCAAAACT...

Protein

Download Protein FASTA

165 aa · TkA01G221370|TK1151|PROTEIN

MEYGWKVNDNIDFDWKKLLHKEKENFHQLEYFREVKNRSMMSVMGNSTNLFWHENTVGKTERQKLINQQGCVVWITGLGGSGEVAKLFADAGLICIASLISPYRKDRDACRVMLTDANFIEAMLTLSFLLILKIMIEQKDGVCPTPCDMAGQVVSYFDENGFLHA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G221370`
TK1151 ID	TkA01G221370
OH-1004 ID	LXL04_033956
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	76.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G221370

Location Chr01:56346895-56349082 (+)

Description Similar to APK3: Adenylyl-sulfate kinase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03900`	Catalyzes the synthesis of activated sulfate for the sulfation of secondary metabolites, including the glucosinolates.	Adenosine-5'-phosphosulfate kinase is essential for Arabidopsis viability.2010 · DOI: 10.1016/j.febslet.2009.11.014
`At2g14750`	Catalyzes the synthesis of activated sulfate.	Molecular and catalytic properties of Arabidopsis thaliana adenylyl sulfate (APS)-kinase.2001 · DOI: 10.1006/abbi.2001.2453
`At4g39940`	Catalyzes the synthesis of activated sulfate.	Molecular and catalytic properties of Arabidopsis thaliana adenylyl sulfate (APS)-kinase.2001 · DOI: 10.1006/abbi.2001.2453 Disruption of adenosine-5'-phosphosulfate kinase in Arabidopsis reduces levels of sulfated secondary metabolites.2009 · DOI: 10.1105/tpc.109.065581 Adenosine-5'-phosphosulfate kinase is essential for Arabidopsis viability.2010 · DOI: 10.1016/j.febslet.2009.11.014 Interaction of glucosinolate content of Arabidopsis thaliana mutant lines and feeding and oviposition by generalist and specialist lepidopterans.2013 · DOI: 10.1016/j.phytochem.2012.11.006
`At5g67520`	Catalyzes the phosphorylation of adenosine 5'-phosphosulfate to 3'-phosphoadenylyl sulfate, which is the activated sulfate form for sulfation reactions.	Adenosine-5'-phosphosulfate kinase is essential for Arabidopsis viability.2010 · DOI: 10.1016/j.febslet.2009.11.014

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033956 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000103 sulfate assimilation Biological Process

GO:0016310 phosphorylation Biological Process

GO:0019344 L-cysteine biosynthetic process Biological Process

GO:0070814 hydrogen sulfide biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004020 adenylylsulfate kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT2G14750

ath:AT3G03900

ath:AT4G39940

ath:AT5G67520

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.405

Rank 1 · TkA01G221370 · TK1151

Extracellular0.195

Rank 2 · TkA01G221370 · TK1151

Nucleus0.193

Rank 3 · TkA01G221370 · TK1151

Mitochondrion0.161

Rank 4 · TkA01G221370 · TK1151

Peroxisome0.061

Rank 5 · TkA01G221370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01583APS_kinase69-82 aa

PF01583APS_kinase82-122 aa

PF29576SMR11_SMR1687-149 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G221370	`PF01583`	APS_kinase	69	82	1.3e-11	45.5
TkA01G221370	`PF01583`	APS_kinase	82	122	1.3e-11	45.5
TkA01G221370	`PF29576`	SMR11_SMR16	87	149	0.098	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRW7`	Arabidopsis thaliana	sp\|Q9SRW7\|APK3_ARATH Adenylyl-sulfate kinase 3	48.200%	Swiss-Prot	Medium
`Q43295`	Arabidopsis thaliana	sp\|Q43295\|APK1_ARATH Adenylyl-sulfate kinase 1, chloroplastic	41.000%	Swiss-Prot	Medium
`O49196`	Arabidopsis thaliana	sp\|O49196\|APK2_ARATH Adenylyl-sulfate kinase 2, chloroplastic	39.700%	Swiss-Prot	Low
`Q84JF0`	Arabidopsis thaliana	sp\|Q84JF0\|APK4_ARATH Adenylyl-sulfate kinase 4, chloroplastic	35.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card