RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G204610
Reference: TK1151 Chr: Chr01 Coordinates: 52089291-52101331 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1869 bp · TkA01G204610|TK1151|cDNA

ATCGTGGATCCCCAATTTGATTTGAAATCAGCGATCCGCCCAAAGCCCCTTCAAACGGCTACATATCTCCCTCCTTGTCCATCCCTCTCTTTGCTGGTATCTCCATAATTTCTCGGTAGTTGTCGGTGGAACCCAAATTCTCTCTCACTATCTCTAATCACCACCCTGAGCACGGTTTCTGAAAGATGAAGCGTTATATGCAACCATTAAACCCTAGTTCGATAAAGCATAGTAAATCTTCTACCCGAAAACAGAAACAT...

CDS

Download CDS FASTA

1626 bp · TkA01G204610|TK1151|CDS

ATGAGGCCACCAAGCAAAAATGAAGAAGAGGGGGAAATCATAGTACAGAAGACATCTGGAGATTCATTGTCCATTCTCGGGCAACCATTTACTTTTGATTCTATAGCTGATGCAACCTCAACTCAGGTGGATATATTCCAGATGGTAGGAGCTCCCCTTGTTGAGAATTGTATTGCTGGATTTAACAGTTCTGTGTTTGCATACGGGCAGACTGGGAGTGGAAAGACATACACGATATGGGGTCCTTCCAATGCATTGTT...

Protein

Download Protein FASTA

541 aa · TkA01G204610|TK1151|PROTEIN

MRPPSKNEEEGEIIVQKTSGDSLSILGQPFTFDSIADATSTQVDIFQMVGAPLVENCIAGFNSSVFAYGQTGSGKTYTIWGPSNALLEDDSSSDQQGLTPRVFERLFLRINEEQNKHTDKQLMYQCRCSFLEIYNEQITDLLDPTQRNLQIREDTKTGVYVENLREESVCSIKDVTQLLKKGLSNRRIGATSINMESSRSHSVFTCVVESRCKSVDGLSSLKTSRINLVDLAGSERQKSTGAAGERLKEAGNINRSLSQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G204610
TK1151 IDTkA01G204610
OH-1004 IDLXL04_004086
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)99.600
Protein coverage (%)TK1151 95.379 / OH-1004 46.154
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G204610
LocationChr01:52089291-52101331 (+)
DescriptionSimilar to KIN12A: Kinesin-like protein KIN-12A
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g23670 Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.
Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis.2007 · DOI: 10.1105/tpc.107.050716
At4g14150 Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.
Identification of a phragmoplast-associated kinesin-related protein in higher plants.2000 · DOI: 10.1016/s0960-9822(00)00564-9
Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis.2007 · DOI: 10.1105/tpc.107.050716

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0350300 Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis. No verified direct reference in this release
Os02g0489800 Kinesin-like protein KIN-12B. No verified direct reference in this release
Os07g0638000 Kinesin-like protein KIN-12E. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_004086 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007018 microtubule-based movement Biological Process
GO:0007112 male meiosis cytokinesis Biological Process
GO:0055046 microgametogenesis Biological Process
GO:0080175 phragmoplast microtubule organization Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005871 kinesin complex Cellular Component
GO:0005874 microtubule Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009524 phragmoplast Cellular Component
GO:0003777 microtubule motor activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0008017 microtubule binding Molecular Function
KEGG gene cross-reference
ath:AT3G23670
ath:AT4G14150
dosa:Os04g0350300
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.654
Rank 1 · TkA01G204610 · TK1151
Nucleus0.359
Rank 2 · TkA01G204610 · TK1151
Cell membrane0.072
Rank 3 · TkA01G204610 · TK1151
Mitochondrion0.067
Rank 4 · TkA01G204610 · TK1151
Golgi apparatus0.048
Rank 5 · TkA01G204610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796Microtub_bd24-142 aa
PF00225Kinesin28-329 aa
PF27935CCDC61_coil127-165 aa
PF31146MIT_ATG38132-181 aa
PF27935CCDC61_coil227-257 aa
PF31146MIT_ATG38252-269 aa
PF23735KIF9324-374 aa
PF31146MIT_ATG38329-370 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G204610PF16796Microtub_bd241429.2e-2071.8
TkA01G204610PF00225Kinesin283291.8e-108363.1
TkA01G204610PF27935CCDC61_coil1271650.2112.9
TkA01G204610PF31146MIT_ATG381321810.113.6
TkA01G204610PF27935CCDC61_coil2272570.2112.9
TkA01G204610PF31146MIT_ATG382522690.113.6
TkA01G204610PF23735KIF93243741.69.6
TkA01G204610PF31146MIT_ATG383293700.113.6
TkA01G204610PF27935CCDC61_coil3373660.2112.9
TkA01G204610PF23735KIF93784261.69.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8L7Y8Arabidopsis thalianasp|Q8L7Y8|KN12B_ARATH Kinesin-like protein KIN-12B64.700%Swiss-ProtHigh
Q9LDN0Arabidopsis thalianasp|Q9LDN0|KN12A_ARATH Kinesin-like protein KIN-12A72.200%Swiss-ProtHigh
Q7XKR9Oryza sativa subsp. japonicasp|Q7XKR9|KN12A_ORYSJ Kinesin-like protein KIN-12A61.500%Swiss-ProtHigh
Q6K765Oryza sativa subsp. japonicasp|Q6K765|KN12B_ORYSJ Kinesin-like protein KIN-12B62.100%Swiss-ProtHigh
B9FUF9Oryza sativa subsp. japonicasp|B9FUF9|KN12E_ORYSJ Kinesin-like protein KIN-12E54.100%Swiss-ProtMedium

JBrowse

View in Genome Browser