TkA01G167910 | RubberDandelionOmics

Gene overview

TkA01G167910

Reference: TK1151 Chr: Chr01 Coordinates: 42967749-42969924 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1713 bp · TkA01G167910|TK1151|cDNA

ACCTTTCAAAAGCCAATCCTCTTCTTCCTTACAATTCTGGTCACTCGTTACTACTATAAAAATCCACAAAACCTCCCCCGACTCATTCTCACTCACACTTCCACACTTCTTCCCCGATCAATCTCAGACCTTCGTCCGAGATCCATGGCCACCGCCGTCTCAACCTTCGGAGCCGCCGTCGCAGTCCCAAGCTCCACCTTCTTGGGCAGCAGCTTGAAGAAGGTAGTGAACACAAGACTCGCCGTCAACAACAACAAGCT...

CDS

Download CDS FASTA

1443 bp · TkA01G167910|TK1151|CDS

ACCTTTCAAAAGCCAATCCTCTTCTTCCTTACAATTCTGGTCACTCGTTACTACTATAAAAATCCACAAAACCTCCCCCGACTCATTCTCACTCACACTTCCACACTTCTTCCCCGATCAATCTCAGACCTTCGTCCGAGATCCATGGCCACCGCCGTCTCAACCTTCGGAGCCGCCGTCGCAGTCCCAAGCTCCACCTTCTTGGGCAGCAGCTTGAAGAAGGTAGTGAACACAAGACTCGCCGTCAACAACAACAAGCT...

Protein

Download Protein FASTA

480 aa · TkA01G167910|TK1151|PROTEIN

TFQKPILFFLTILVTRYYYKNPQNLPRLILTHTSTLLPRSISDLRPRSMATAVSTFGAAVAVPSSTFLGSSLKKVVNTRLAVNNNKLPSFKVLAAEKEIEETQQTDKDRWKGLAYDMSDDQQDITRGKGMVDSLFQAPQDVGTHFAVMSSYEYISTGLRTYNLDNNMGGFYIAPAFMDKLVVHITKNFMTLPNIKVPLILGVWGGKGQGKSFQCELVFAKMGITPIMMSAGELESGNAGEPAKLIRQRYREAADIIKKGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G167910`
TK1151 ID	TkA01G167910
OH-1004 ID	LXL04_012381
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 96.667 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G167910

Location Chr01:42967749-42969924 (-)

Description Similar to RCA: Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0707000`	Activation of RuBisCO (ribulose-1,5-bisphosphate carboxylase/oxygenase; EC 4.1.1.39) involves the ATP-dependent carboxylation of the epsilon-amino group of lysine leading to a carbamate structure.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012381 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0046863 ribulose-1,5-bisphosphate carboxylase/oxygenase activator activity Molecular Function

KEGG gene cross-reference

dosa:Os11g0707000

mdm:103456062

vra:106757684

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.747

Rank 1 · TkA01G167910 · TK1151

Nucleus0.091

Rank 2 · TkA01G167910 · TK1151

Cytoplasm0.091

Rank 3 · TkA01G167910 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA01G167910 · TK1151

Mitochondrion0.049

Rank 5 · TkA01G167910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06309Torsin166-220 aa

PF00004AAA202-345 aa

PF00154RecA_N223-283 aa

PF21228RuBisCO_activase_AAA_helical348-443 aa

PF00154RecA_N377-420 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G167910	`PF06309`	Torsin	166	220	0.0024	18.7
TkA01G167910	`PF00004`	AAA	202	345	4.9e-17	63.3
TkA01G167910	`PF00154`	RecA_N	223	283	0.1	12.7
TkA01G167910	`PF21228`	RuBisCO_activase_AAA_helical	348	443	1.5e-40	138.1
TkA01G167910	`PF00154`	RecA_N	377	420	0.1	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93431`	Oryza sativa subsp. japonica	sp\|P93431\|RCA_ORYSJ Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic	81.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card