LXL04_012381 | RubberDandelionOmics

Gene overview

LXL04_012381

Reference: OH-1004 Chr: Chr03 Coordinates: 11418269-11420052 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1431 bp · LXL04_012381|LXL04_012381|OH1004|cDNA

ACCTTTCAAAAGCCAATCCTCTTCTTCCTTACAATTCTGGTCACTCGTTACTACTATAAAAATCCACAAAACCTCCCCCGACTCATTCTCACTCACACTTCCACACTTCTTCCCCGATCAATCTCAGACCTTCGTCCGAGATCCATGGCCACCGCCGTCTCAACCTTCGGAGCCGCCGTCGCAGTCCCAAGCTCCACCTTCTTGGGCAGCAGCTTGAAGAAGGTAGTGAACACAAGACTCGCCGTCAACAACACCAAGCT...

CDS

Download CDS FASTA

1395 bp · LXL04_012381|LXL04_012381|OH1004|CDS

CTGGTCACTCGTTACTACTATAAAAATCCACAAAACCTCCCCCGACTCATTCTCACTCACACTTCCACACTTCTTCCCCGATCAATCTCAGACCTTCGTCCGAGATCCATGGCCACCGCCGTCTCAACCTTCGGAGCCGCCGTCGCAGTCCCAAGCTCCACCTTCTTGGGCAGCAGCTTGAAGAAGGTAGTGAACACAAGACTCGCCGTCAACAACACCAAGCTTCCGTCGTTCAAAGTCTTGGCAGCTGAGAAAGAGAT...

Protein

Download Protein FASTA

464 aa · LXL04_012381|LXL04_012381|OH1004|PROTEIN

MVTRYYYKNPQNLPRLILTHTSTLLPRSISDLRPRSMATAVSTFGAAVAVPSSTFLGSSLKKVVNTRLAVNNTKLPSFKVLAAEKEIEETQQTDKDRWKGLAYDMSDDQQDITRGKGMVDSLFQAPQDVGTHFAVMSSYEYISTGLRTYNLDNNMGGFYIAPAFMDKLVVHITKNFMTLPNIKVPLILGVWGGKGQGKSFQCELVFAKMGITPIMMSAGELESGNAGEPAKLIRQRYREAADIIKKGKMCCLFINDLDAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012381`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012381

Location Chr03:11418269-11420052 (+)

Description Similar to RCA: Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0707000`	Activation of RuBisCO (ribulose-1,5-bisphosphate carboxylase/oxygenase; EC 4.1.1.39) involves the ATP-dependent carboxylation of the epsilon-amino group of lysine leading to a carbamate structure.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012381 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0046863 ribulose-1,5-bisphosphate carboxylase/oxygenase activator activity Molecular Function

KEGG gene cross-reference

dosa:Os11g0707000

mdm:103456062

vra:106757684

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.746

Rank 1 · LXL04_012381 · OH-1004

Nucleus0.089

Rank 2 · LXL04_012381 · OH-1004

Cytoplasm0.087

Rank 3 · LXL04_012381 · OH-1004

Mitochondrion0.060

Rank 4 · LXL04_012381 · OH-1004

Endoplasmic reticulum0.052

Rank 5 · LXL04_012381 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00004.36AAA190-333 aa

PF21228.4RuBisCO_activase_AAA_helical336-431 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012381	`PF00004.36`	AAA	190	333	4.6e-17	63.4
LXL04_012381	`PF21228.4`	RuBisCO_activase_AAA_helical	336	431	1.5e-40	138.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93431`	Oryza sativa subsp. japonica	Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic	80.831%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card