TkA01G110030 | RubberDandelionOmics

Gene overview

TkA01G110030

Reference: TK1151 Chr: Chr01 Coordinates: 27953121-27959192 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1808 bp · TkA01G110030|TK1151|cDNA

TTTGGCACTTGTCTTAAGCAAAACTTCCTCAACTTCTTTAAAATTATATAACCTTATCATTTCTTCTCTTGTGCACTTCAGACATAGGAATGGCACCATGGATTCTTCTCATGTTCCGCTCATTACTAATTTTGCTAGCAACTCCCTCATCTTTTGCAAAGTTTCCATCTAGGTACTTTCCTTCTTCAATTATCCACCCCGAAACACCATCTCTTTCTAGCAATACCAACTTGCTTTACAAAACAAGATACTTCACCCAA...

CDS

Download CDS FASTA

822 bp · TkA01G110030|TK1151|CDS

ATGGCACCATGGATTCTTCTCATGTTCCGCTCATTACTAATTTTGCTAGCAACTCCCTCATCTTTTGCAAAGTTTCCATCTAGGTACTTTCCTTCTTCAATTATCCACCCCGAAACACCATCTCTTTCTAGCAATACCAACTTGCTTTACAAAACAAGATACTTCACCCAAATTCTTGATCACTTCAATTACAATCCACAAAGTTACCAAACCTTCCAACAACGTTATCTGATCAATGACACATTCTGGGGCGGCCGCAA...

Protein

Download Protein FASTA

273 aa · TkA01G110030|TK1151|PROTEIN

MAPWILLMFRSLLILLATPSSFAKFPSRYFPSSIIHPETPSLSSNTNLLYKTRYFTQILDHFNYNPQSYQTFQQRYLINDTFWGGRKSKSPIFVYTGNEGNIEWFAQNTGFMYDIAPKFKALLIFLEHRYYGKSIPYGGNRKKAYKNSKNLGYLSSTQALADYATLILDLKNNLTTMDSPVIVFGGSYGGMLAAWFRLKYPHVAIGALASSAPILQFENITSQYSFNNIITQDFKSESENCYKVIKGSWKQIEDTATSKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G110030`
TK1151 ID	TkA01G110030
OH-1004 ID	LXL04_004800
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 53.953 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G110030`
Location	Chr01:27953121-27959192 (-)
Description	Similar to PRCP: Lysosomal Pro-X carboxypeptidase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004800` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002003 angiotensin maturation Biological Process GO:0002155 regulation of thyroid hormone receptor signaling pathway Biological Process GO:0003085 negative regulation of systemic arterial blood pressure Biological Process GO:0006508 proteolysis Biological Process GO:0030163 protein catabolic process Biological Process GO:0042593 glucose homeostasis Biological Process GO:0043535 regulation of blood vessel endothelial cell migration Biological Process GO:0097009 energy homeostasis Biological Process GO:1905146 lysosomal protein catabolic process Biological Process GO:2000377 regulation of reactive oxygen species metabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005764 lysosome Cellular Component
KEGG gene cross-reference	bta:534927 hsa:5547 mmu:72461 pon:100172335 rno:83799 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.372

Rank 1 · TkA01G110030 · TK1151

Extracellular0.310

Rank 2 · TkA01G110030 · TK1151

Cytoplasm0.094

Rank 3 · TkA01G110030 · TK1151

Endoplasmic reticulum0.077

Rank 4 · TkA01G110030 · TK1151

Golgi apparatus0.071

Rank 5 · TkA01G110030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561Abhydrolase_148-100 aa

PF05577Peptidase_S2857-272 aa

PF11144DUF292057-94 aa

PF00326Peptidase_S958-77 aa

PF00561Abhydrolase_1105-203 aa

PF21440aSelB_III111-122 aa

PF12146Hydrolase_4156-219 aa

PF00326Peptidase_S9156-220 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G110030	`PF00561`	Abhydrolase_1	48	100	0.00043	20.8
TkA01G110030	`PF05577`	Peptidase_S28	57	272	1.6e-58	199.3
TkA01G110030	`PF11144`	DUF2920	57	94	0.069	13.0
TkA01G110030	`PF00326`	Peptidase_S9	58	77	0.0023	18.2
TkA01G110030	`PF00561`	Abhydrolase_1	105	203	0.00043	20.8
TkA01G110030	`PF21440`	aSelB_III	111	122	0.25	12.1
TkA01G110030	`PF12146`	Hydrolase_4	156	219	9.7e-05	22.5
TkA01G110030	`PF00326`	Peptidase_S9	156	220	0.0023	18.2
TkA01G110030	`PF12697`	Abhydrolase_6	158	211	0.024	16.0
TkA01G110030	`PF11144`	DUF2920	162	212	0.069	13.0
TkA01G110030	`PF21440`	aSelB_III	202	247	0.25	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card