TkA01G100640 | RubberDandelionOmics

Gene overview

TkA01G100640

Reference: TK1151 Chr: Chr01 Coordinates: 25467005-25469477 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1438 bp · TkA01G100640|TK1151|cDNA

TCCCCTTTTCAAACTTCTATTTATACCCCTTCGGATTCTTGTAAATTGTAATTAACTCTTATCTTTAAGAAACACAAATGGGTTCTCTTCCTCATGTCGTGGAAGACTGTCACGGAATTGTTCAGATCTTTAGCGACGGTTCCATCCATCGCCACCAAAACATTGACTTTTCTGCATTTCCTGTTAACGACGACGGTTCTGTTGTCTGGAGAGACTATTGCTATGACAAACGCCATGACCTCCACCTCCGGATCTACAAG...

CDS

Download CDS FASTA

987 bp · TkA01G100640|TK1151|CDS

ATGGGTTCTCTTCCTCATGTCGTGGAAGACTGTCACGGAATTGTTCAGATCTTTAGCGACGGTTCCATCCATCGCCACCAAAACATTGACTTTTCTGCATTTCCTGTTAACGACGACGGTTCTGTTGTCTGGAGAGACTATTGCTATGACAAACGCCATGACCTCCACCTCCGGATCTACAAGCCCAAATCAACCACCACCAAACTCCCCGTCGTCTACTACCTCCACGGTGGTGGGTTCTGTCTTGGGTCGTTCTCATG...

Protein

Download Protein FASTA

328 aa · TkA01G100640|TK1151|PROTEIN

MGSLPHVVEDCHGIVQIFSDGSIHRHQNIDFSAFPVNDDGSVVWRDYCYDKRHDLHLRIYKPKSTTTKLPVVYYLHGGGFCLGSFSWPNHHNCCLRLSSVLHAIIVAPDYRLAPEHRLPAAVDDSLAALKWLQKLAVNPKDVQATDMWIGDLVERSFDFDRVFIIGDSSGGNIAHHMAVRYGPGSPELTPVKIRGYVMLAPFFGGKERTASEAKGLPEKFLNVDILDTFWRMSLPKGKTADHPIANPFGPKSPSLESIDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G100640`
TK1151 ID	TkA01G100640
OH-1004 ID	LXL04_035459
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	52.800
Protein coverage (%)	TK1151 97.866 / OH-1004 98.119 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G100640

Location Chr01:25467005-25469477 (+)

Description Similar to CXE15: Probable carboxylesterase 15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06570`	May bind strigolactones and catalyze their hydrolysis.	Catabolism of strigolactones by a carboxylesterase.2021 · DOI: 10.1038/s41477-021-01011-y Structural insights into strigolactone catabolism by carboxylesterases reveal a conserved conformational regulation.2024 · DOI: 10.1038/s41467-024-50928-3
`At5g27320`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x
`At1g68620`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At5g62180`	Carboxylesterase that possesses esterase activity in vitro with the synthetic substrate p-nitrophenyl acetate (pNPA).	Arabidopsis Carboxylesterase 20 Binds Strigolactone and Increases Branches and Tillers When Ectopically Expressed in Arabidopsis and Maize.2021 · DOI: 10.3389/fpls.2021.639401 Structural insights into strigolactone catabolism by carboxylesterases reveal a conserved conformational regulation.2024 · DOI: 10.1038/s41467-024-50928-3
`At3g63010`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035459 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1901600 strigolactone metabolic process Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016787 hydrolase activity Molecular Function

GO:0016829 lyase activity Molecular Function

GO:0052689 carboxylic ester hydrolase activity Molecular Function

GO:0106435 carboxylesterase activity Molecular Function

KEGG gene cross-reference

ag:BAM20978

ag:BAM20979

ath:AT1G68620

ath:AT5G06570

ath:AT5G16080

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.847

Rank 1 · TkA01G100640 · TK1151

Nucleus0.318

Rank 2 · TkA01G100640 · TK1151

Endoplasmic reticulum0.055

Rank 3 · TkA01G100640 · TK1151

Cell membrane0.040

Rank 4 · TkA01G100640 · TK1151

Mitochondrion0.040

Rank 5 · TkA01G100640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00756Esterase53-79 aa

PF00135COesterase55-114 aa

PF20434BD-FAE57-179 aa

PF10340Say1_Mug18070-174 aa

PF07859Abhydrolase_372-304 aa

PF00756Esterase152-181 aa

PF00561Abhydrolase_1154-210 aa

PF12146Hydrolase_4157-220 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G100640	`PF00756`	Esterase	53	79	0.087	13.3
TkA01G100640	`PF00135`	COesterase	55	114	1.7e-07	31.3
TkA01G100640	`PF20434`	BD-FAE	57	179	1e-12	48.7
TkA01G100640	`PF10340`	Say1_Mug180	70	174	3.5e-05	23.5
TkA01G100640	`PF07859`	Abhydrolase_3	72	304	2.7e-54	184.8
TkA01G100640	`PF00756`	Esterase	152	181	0.087	13.3
TkA01G100640	`PF00561`	Abhydrolase_1	154	210	0.0035	17.8
TkA01G100640	`PF12146`	Hydrolase_4	157	220	0.003	17.6
TkA01G100640	`PF00135`	COesterase	160	177	1.7e-07	31.3
TkA01G100640	`PF00561`	Abhydrolase_1	246	304	0.0035	17.8
TkA01G100640	`PF10340`	Say1_Mug180	263	295	3.5e-05	23.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FG13`	Arabidopsis thaliana	sp\|Q9FG13\|CXE15_ARATH Strigolactones hydrolase CXE15	53.900%	Swiss-Prot	High
`Q940G6`	Arabidopsis thaliana	sp\|Q940G6\|GID1C_ARATH Gibberellin receptor GID1C	32.000%	Swiss-Prot	Medium
`Q9SX25`	Arabidopsis thaliana	sp\|Q9SX25\|CXE6_ARATH Probable carboxylesterase 6	36.800%	Swiss-Prot	Medium
`Q9LVB8`	Arabidopsis thaliana	sp\|Q9LVB8\|CXE20_ARATH Carboxylesterase 20	35.400%	Swiss-Prot	Medium
`Q9LYC1`	Arabidopsis thaliana	sp\|Q9LYC1\|GID1B_ARATH Gibberellin receptor GID1B	34.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card