TkA01G098260 | RubberDandelionOmics

Gene overview

TkA01G098260

Reference: TK1151 Chr: Chr01 Coordinates: 24821246-24824806 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1521 bp · TkA01G098260|TK1151|cDNA

AATAAAGTAGCAACACTATTGGGTTTAAAAAAAGTTTTTCCAACAGTGGGATCAGTGTAGTATATAAACCAGCGAGGCAAGGATTTCTAGACAACCCGTACAAGTCTCTTTAATCAACTTTAGCTTCCAATAGTGAATATGAGTAAATATGAGGGCATGAGCGAATTCTTTCACAAGGGGAAGCCCTATTTTGGTGTTTTTTTCATTCAGTTTGGGTTCGCTGGAATGGACATCCTTTCTAAAGTCGCATTAAATGAAGG...

CDS

Download CDS FASTA

1116 bp · TkA01G098260|TK1151|CDS

ATGAGTAAATATGAGGGCATGAGCGAATTCTTTCACAAGGGGAAGCCCTATTTTGGTGTTTTTTTCATTCAGTTTGGGTTCGCTGGAATGGACATCCTTTCTAAAGTCGCATTAAATGAAGGAATGAGCAATTACGTATTTGTTGTATATCGCCATGTTGTCGCCACTCTTGTCATGGCTCCTTTCGCTATTCTTTTCGACAGGAAAACACGGCCAAAAATGACTCGTTCGATTTTCCTCAAGATTATGCTTCTTGCACT...

Protein

Download Protein FASTA

371 aa · TkA01G098260|TK1151|PROTEIN

MSKYEGMSEFFHKGKPYFGVFFIQFGFAGMDILSKVALNEGMSNYVFVVYRHVVATLVMAPFAILFDRKTRPKMTRSIFLKIMLLALLEPVIDQNLYIMGLKATTATFAAAMSNVLPAITFVMACILRVEKLNIKSIYSQAKITGTVATVAGAMVMTLIKGPILELFWTRGRTYHEVATNGVDLHGSLKGAIMITVGCFSWSGFMILQSITLESYPAELSLTAWICLMGTIEGTIVALIMERGNPGVWAIKWDTSLLACV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G098260`
TK1151 ID	TkA01G098260
OH-1004 ID	LXL04_004900
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G098260

Location Chr01:24821246-24824806 (-)

Description Similar to At2g37460: WAT1-related protein At2g37460

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37460`	WAT1-related protein At2g37460.	No verified direct reference in this release
`At2g39510`	WAT1-related protein At2g39510.	No verified direct reference in this release
`At2g37450`	WAT1-related protein At2g37450.	No verified direct reference in this release
`At5g07050`	WAT1-related protein At5g07050.	No verified direct reference in this release
`At4g08290`	WAT1-related protein At4g08290.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004900 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009620 response to fungus Biological Process

GO:0048316 seed development Biological Process

GO:0098712 L-glutamate import across plasma membrane Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015186 L-glutamine transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G37450

ath:AT2G37460

ath:AT2G39510

ath:AT4G08290

ath:AT5G07050

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.516

Rank 1 · TkA01G098260 · TK1151

Lysosome / Vacuole0.183

Rank 2 · TkA01G098260 · TK1151

Endoplasmic reticulum0.162

Rank 3 · TkA01G098260 · TK1151

Golgi apparatus0.067

Rank 4 · TkA01G098260 · TK1151

Cytoplasm0.065

Rank 5 · TkA01G098260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00892EamA18-155 aa

PF04246RseC_MucC99-156 aa

PF11381DUF3185143-154 aa

PF09534Trp_oprn_chp143-154 aa

PF00892EamA189-328 aa

PF11381DUF3185268-280 aa

PF09534Trp_oprn_chp278-332 aa

PF04246RseC_MucC292-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G098260	`PF00892`	EamA	18	155	9.5e-25	88.2
TkA01G098260	`PF04246`	RseC_MucC	99	156	1.2	9.7
TkA01G098260	`PF11381`	DUF3185	143	154	0.068	13.8
TkA01G098260	`PF09534`	Trp_oprn_chp	143	154	0.13	12.8
TkA01G098260	`PF00892`	EamA	189	328	9.5e-25	88.2
TkA01G098260	`PF11381`	DUF3185	268	280	0.068	13.8
TkA01G098260	`PF09534`	Trp_oprn_chp	278	332	0.13	12.8
TkA01G098260	`PF04246`	RseC_MucC	292	334	1.2	9.7
TkA01G098260	`PF11381`	DUF3185	313	334	0.068	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUS1`	Arabidopsis thaliana	sp\|Q9ZUS1\|WTR13_ARATH WAT1-related protein At2g37460	64.800%	Swiss-Prot	High
`O80638`	Arabidopsis thaliana	sp\|O80638\|WTR14_ARATH WAT1-related protein At2g39510	59.400%	Swiss-Prot	High
`F4IQX1`	Arabidopsis thaliana	sp\|F4IQX1\|WTR12_ARATH WAT1-related protein At2g37450	58.000%	Swiss-Prot	High
`Q9FL41`	Arabidopsis thaliana	sp\|Q9FL41\|WTR38_ARATH WAT1-related protein At5g07050	48.000%	Swiss-Prot	Medium
`Q9SUF1`	Arabidopsis thaliana	sp\|Q9SUF1\|WTR31_ARATH WAT1-related protein At4g08290	50.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card