TkA01G097940 | RubberDandelionOmics

Gene overview

TkA01G097940

Reference: TK1151 Chr: Chr01 Coordinates: 24721838-24726229 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2446 bp · TkA01G097940|TK1151|cDNA

TAAAAAGTAGATTTTTAAATTTCGTTGCACGTGGTAGTTGGTAATTGATGTTTAAAATACTTTACAATGATCGAACGGTAGATTTTCCTACCACTGCGCGTTGATTTTTCCGGCAACATCAGGCCCTAGCGCCGCCGCATTTGGTCCCCAACATTCTTATCGACTCATCGTCAACTTTACCACCACCCTTGACCCTTGTACTCTTCTACATAATCCCAATGTCTGCTTCTCCACCACCGCAGCAAAAAATCACCGCATCC...

CDS

Download CDS FASTA

2013 bp · TkA01G097940|TK1151|CDS

ATGTCTGCTTCTCCACCACCGCAGCAAAAAATCACCGCATCCTACGGTTCCTGGTCGTCCCCAATCACCTCCGACATCGTTTCCGGCGCTGCCAAGACCCTCGGAGGCACCGCCGTTGACTCCCTCGGCCGTCTCATCTTGCTCGAATCACGCCCCACCGAGTCCGGACGTTCGGTTTTAGTTAGAGGAGGAGATAACGACGATGAAGCTACTGATATAACGCCACCAGAGTTCTCCGTCCGTACAGTTGCTCAAGATTA...

Protein

Download Protein FASTA

670 aa · TkA01G097940|TK1151|PROTEIN

MSASPPPQQKITASYGSWSSPITSDIVSGAAKTLGGTAVDSLGRLILLESRPTESGRSVLVRGGDNDDEATDITPPEFSVRTVAQDYGGGDFSVSGETVIFSNYKDQRLYKQSIGSPPVAITPDYGEPLVCYADGVFDKRFNRYVTIREDRRESSKNSVATIVSIELNDGIIQDPKVLVGGNDFYAFPRLDHEGKRMAWIEWAHPNMPWDRSQLWVGYISNNGEVCKRVCVAGGDPTIVESPTEPKWSSEGELFFVTDRN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G097940`
TK1151 ID	TkA01G097940
OH-1004 ID	LXL04_004913
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 92.541 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G097940`
Location	Chr01:24721838-24726229 (+)
Description	Similar to dapb3: Dipeptidyl aminopeptidase BIII
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004913` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0050435 amyloid-beta metabolic process Biological Process GO:0051603 proteolysis involved in protein catabolic process Biological Process GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0004175 endopeptidase activity Molecular Function GO:0004177 aminopeptidase activity Molecular Function GO:0004252 serine-type endopeptidase activity Molecular Function GO:0008236 serine-type peptidase activity Molecular Function GO:0008239 dipeptidyl-peptidase activity Molecular Function GO:0008242 omega peptidase activity Molecular Function GO:0042802 identical protein binding Molecular Function
KEGG gene cross-reference	bsu:BSU32230 cel:CELE_F44B9.1 rno:24206 ure:UREG_02301 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.803

Rank 1 · TkA01G097940 · TK1151

Nucleus0.319

Rank 2 · TkA01G097940 · TK1151

Peroxisome0.065

Rank 3 · TkA01G097940 · TK1151

Mitochondrion0.062

Rank 4 · TkA01G097940 · TK1151

Cell membrane0.037

Rank 5 · TkA01G097940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05705DUF829369-406 aa

PF00326Peptidase_S9378-437 aa

PF00326Peptidase_S9453-653 aa

PF20434BD-FAE490-612 aa

PF02129Peptidase_S15492-548 aa

PF07859Abhydrolase_3493-631 aa

PF05448AXE1494-544 aa

PF01738DLH501-637 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G097940	`PF05705`	DUF829	369	406	0.2	12.2
TkA01G097940	`PF00326`	Peptidase_S9	378	437	5.3e-44	151.0
TkA01G097940	`PF00326`	Peptidase_S9	453	653	5.3e-44	151.0
TkA01G097940	`PF20434`	BD-FAE	490	612	6.5e-09	36.3
TkA01G097940	`PF02129`	Peptidase_S15	492	548	0.00013	22.5
TkA01G097940	`PF07859`	Abhydrolase_3	493	631	2.5e-05	24.9
TkA01G097940	`PF05448`	AXE1	494	544	0.00024	20.7
TkA01G097940	`PF01738`	DLH	501	637	5.3e-10	40.0
TkA01G097940	`PF12146`	Hydrolase_4	501	531	4e-05	23.8
TkA01G097940	`PF12740`	PETase	507	540	0.17	12.1
TkA01G097940	`PF02129`	Peptidase_S15	574	616	0.00013	22.5
TkA01G097940	`PF12146`	Hydrolase_4	581	629	4e-05	23.8
TkA01G097940	`PF03959`	FSH1	582	626	0.099	13.0
TkA01G097940	`PF05705`	DUF829	582	630	0.2	12.2
TkA01G097940	`PF12740`	PETase	584	638	0.17	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card