TkA01G092610 | RubberDandelionOmics

Gene overview

TkA01G092610

Reference: TK1151 Chr: Chr01 Coordinates: 23408882-23409601 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

720 bp · TkA01G092610|TK1151|cDNA

GCACCATGTCCAGGTCTGGCGCAGGTTTTCCGGCTATCGGAACTCAAAGACGCGACTAATGGATTCAAAGAGTTTAACGAATTAGGAAGAGGAAGTTACGGGTTCGTTTACAGAGCTGTGTTACCGGACGGCCGGCAAGTGGCGGTGAAAAGAGCAAACGCTGCGACGATCATTCATACGAACAGTCGGGAATTTGAAATGGAGCTTGAAATTCTTTGCAGCGTTCGTCATAGTAATGTCGTGAATTTGTTAGGTTATTG...

CDS

Download CDS FASTA

720 bp · TkA01G092610|TK1151|CDS

GCACCATGTCCAGGTCTGGCGCAGGTTTTCCGGCTATCGGAACTCAAAGACGCGACTAATGGATTCAAAGAGTTTAACGAATTAGGAAGAGGAAGTTACGGGTTCGTTTACAGAGCTGTGTTACCGGACGGCCGGCAAGTGGCGGTGAAAAGAGCAAACGCTGCGACGATCATTCATACGAACAGTCGGGAATTTGAAATGGAGCTTGAAATTCTTTGCAGCGTTCGTCATAGTAATGTCGTGAATTTGTTAGGTTATTG...

Protein

Download Protein FASTA

239 aa · TkA01G092610|TK1151|PROTEIN

APCPGLAQVFRLSELKDATNGFKEFNELGRGSYGFVYRAVLPDGRQVAVKRANAATIIHTNSREFEMELEILCSVRHSNVVNLLGYCAEMGERLLVYELMPHGTLHDHLHGGFSPLNWPLRLRITMQAAKGLEFLHTEFNPPIAHRDVKSSNILLDSDWGARISDFGLLRNDGDVILDMRDDVYNFGVVLLEILSGRKANDRDCTPSNIVEWAVPLIKQGRAAAIIDRCVVCHVSSCHC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G092610`
TK1151 ID	TkA01G092610
OH-1004 ID	LXL04_004973
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 96.234 / OH-1004 30.263 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G092610

Location Chr01:23408882-23409601 (+)

Description Similar to CCR1: Serine/threonine-protein kinase-like protein CCR1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09780`	Serine/threonine-protein kinase with low activity.	No verified direct reference in this release
`At2g39180`	Serine/threonine-protein kinase with low activity.	No verified direct reference in this release
`At3g59420`	Controls formative cell division in meristems, including root tips and lateral root initiation zones of the pericycle, in response to CLE40 signal.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0637800`	Receptor protein kinase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004973 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009786 regulation of asymmetric cell division Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010311 lateral root formation Biological Process

GO:0032877 positive regulation of DNA endoreduplication Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0048364 root development Biological Process

GO:0048439 flower morphogenesis Biological Process

GO:0048829 root cap development Biological Process

GO:0090392 sepal giant cell differentiation Biological Process

GO:0090627 plant epidermal cell differentiation Biological Process

GO:0099402 plant organ development Biological Process

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G39180

ath:AT3G09780

ath:AT3G59420

dosa:Os03g0637800

zma:542346

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.523

Rank 1 · TkA01G092610 · TK1151

Cytoplasm0.398

Rank 2 · TkA01G092610 · TK1151

Nucleus0.275

Rank 3 · TkA01G092610 · TK1151

Golgi apparatus0.038

Rank 4 · TkA01G092610 · TK1151

Endoplasmic reticulum0.035

Rank 5 · TkA01G092610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03109ABC18-52 aa

PF00069Pkinase23-170 aa

PF07714PK_Tyr_Ser-Thr26-171 aa

PF03109ABC1136-171 aa

PF07714PK_Tyr_Ser-Thr180-211 aa

PF00069Pkinase181-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G092610	`PF03109`	ABC1	8	52	3.1e-06	27.2
TkA01G092610	`PF00069`	Pkinase	23	170	6.4e-30	105.2
TkA01G092610	`PF07714`	PK_Tyr_Ser-Thr	26	171	1.3e-33	117.1
TkA01G092610	`PF03109`	ABC1	136	171	3.1e-06	27.2
TkA01G092610	`PF07714`	PK_Tyr_Ser-Thr	180	211	1.3e-33	117.1
TkA01G092610	`PF00069`	Pkinase	181	198	6.4e-30	105.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S7D9`	Arabidopsis thaliana	sp\|Q9S7D9\|ACCR1_ARATH Serine/threonine-protein kinase-like protein CCR1	73.500%	Swiss-Prot	High
`O80963`	Arabidopsis thaliana	sp\|O80963\|ACCR2_ARATH Serine/threonine-protein kinase-like protein CCR2	70.800%	Swiss-Prot	High
`Q9LX29`	Arabidopsis thaliana	sp\|Q9LX29\|ACR4L_ARATH Serine/threonine-protein kinase-like protein ACR4	47.000%	Swiss-Prot	Medium
`Q75J39`	Oryza sativa subsp. japonica	sp\|Q75J39\|CKI4_ORYSJ Serine/threonine-protein kinase-like protein CR4	46.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card