TkA01G090080 | RubberDandelionOmics

Gene overview

TkA01G090080

Reference: TK1151 Chr: Chr01 Coordinates: 22887056-22900807 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2661 bp · TkA01G090080|TK1151|cDNA

TTTAGTTTGAGTATTGTGTTAGTTCAGATTCTCTTTTTACTTTATTTCCATGAGTCGATTGATGATATCAAATAACTTATATTCTTGTATGTATACATTCTTTCCAATGTATATTTCTTGGATATGATGCCATATAGTTGTCATAATTAAATTACTCGCCTAATTGTATTGCACTTTTATATATTTCACGTTTTACTATGTTAATCACGTTCCTGATGTTAATCACGTTCCTGACATATTTCCCTAATCATTAACAATGT...

CDS

Download CDS FASTA

5442 bp · TkA01G090080|TK1151|CDS

ATGAGAAGTAAAAGGCTAGAATCTTCCTTCCCCTTAACAGATCGCGACATTGAGAATTCAGGAGAAGGAAGTGGCGATTTTGAGAAGCTTCAAGAACATGAGCTGATTTTCAAAGAAATACAAGGATTGGAGGTGAAATTGAAGAAGATTGAAGTGTTTAAAGGTAAGGAATCATCTCCTATGCTTAAGATTTTCGTTTTTATGGTTGGAGGTTCAAACCCAAGTCAAGTTTTGATAAAATTGGAGGTAGTAGTTCTCAT...

Protein

Download Protein FASTA

1813 aa · TkA01G090080|TK1151|PROTEIN

MRSKRLESSFPLTDRDIENSGEGSGDFEKLQEHELIFKEIQGLEVKLKKIEVFKGKESSPMLKIFVFMVGGSNPSQVLIKLEVVVLMHRKFGSFEVMLARGMKIWSLSIRQFSLYYDDDKKKVVINSIEGPIIGTTALIWPGGRSHRHTDLCHDKLVSLRGSSAKEITRDALLEKVTQEREFRNYMRRATAASLFIQRVWRRYASTKMAAAHLREEWQEMLKCHPVPITRAWISNNLLKPFLFFIRISATRHQRFEDRDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G090080`
TK1151 ID	TkA01G090080
OH-1004 ID	LXL04_005069
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.600
Protein coverage (%)	TK1151 60.397 / OH-1004 96.919 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G090080

Location Chr01:22887056-22900807 (-)

Description Similar to UPL7: E3 ubiquitin-protein ligase UPL7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53090`	Probable E3 ubiquitin-protein ligase which mediates ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005069 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT3G17205

ath:AT3G53090

hsa:89910

mmu:117146

xtr:780337

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.411

Rank 1 · TkA01G090080 · TK1151

Cell membrane0.232

Rank 2 · TkA01G090080 · TK1151

Nucleus0.209

Rank 3 · TkA01G090080 · TK1151

Mitochondrion0.174

Rank 4 · TkA01G090080 · TK1151

Endoplasmic reticulum0.150

Rank 5 · TkA01G090080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16058Mucin-like563-567 aa

PF00632HECT965-1252 aa

PF02987LEA_41328-1348 aa

PF28971COR151329-1406 aa

PF02987LEA_41360-1391 aa

PF02987LEA_41383-1417 aa

PF28971COR151397-1470 aa

PF02987LEA_41415-1444 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G090080	`PF16058`	Mucin-like	563	567	0.15	13.2
TkA01G090080	`PF00632`	HECT	965	1252	6.4e-84	282.9
TkA01G090080	`PF02987`	LEA_4	1328	1348	4e-99	325.0
TkA01G090080	`PF28971`	COR15	1329	1406	3.6e-12	47.1
TkA01G090080	`PF02987`	LEA_4	1360	1391	4e-99	325.0
TkA01G090080	`PF02987`	LEA_4	1383	1417	4e-99	325.0
TkA01G090080	`PF28971`	COR15	1397	1470	3.6e-12	47.1
TkA01G090080	`PF02987`	LEA_4	1415	1444	4e-99	325.0
TkA01G090080	`PF16058`	Mucin-like	1423	1423	0.15	13.2
TkA01G090080	`PF02987`	LEA_4	1445	1480	4e-99	325.0
TkA01G090080	`PF28971`	COR15	1468	1532	3.6e-12	47.1
TkA01G090080	`PF02987`	LEA_4	1486	1524	4e-99	325.0
TkA01G090080	`PF16058`	Mucin-like	1507	1576	0.15	13.2
TkA01G090080	`PF02987`	LEA_4	1518	1550	4e-99	325.0
TkA01G090080	`PF28971`	COR15	1524	1598	3.6e-12	47.1
TkA01G090080	`PF02987`	LEA_4	1551	1590	4e-99	325.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCQ2`	Arabidopsis thaliana	sp\|Q9SCQ2\|UPL7_ARATH E3 ubiquitin-protein ligase UPL7	55.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card