TkA01G054470 | RubberDandelionOmics

Gene overview

TkA01G054470

Reference: TK1151 Chr: Chr01 Coordinates: 14070696-14074384 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3371 bp · TkA01G054470|TK1151|cDNA

TGTACATAAATCAAGATTCATCCGTTTCGCCTCACGAAAAAGGGTTAGCCATTGACAGCAACAAAAATCCACCACAAACCATCACTATATTTAGTAAAGTTCACCATACACACGCCATATACTTCAATCCTCCGCCATGGTTTTGCTTTCAAGTTGTTAACCCCAAAAATTTGGATATTTTTCCTCAATTAATTCATAAAATGGCTTCCGGGAGTAGAACAAGCTCAAGGCTTCATCTCCATAGTAACAACCAAGCGTCG...

CDS

Download CDS FASTA

1110 bp · TkA01G054470|TK1151|CDS

ATGATCGTCGACTGTCACGCAACCCCTGTTCACGTAATCCAAGACGAATCATTGATGCAACCGTTGAGCTTAGTGGGTTCGACCCTTCGAGCCCCCCATGGCTGCCATGCTCAGTACATGGCTAACATGGGGTCGATGTCGTCGTTAGCCATGGCGGTCATTATAAACGGGTTAGATGATGAAAATTCAGGAGTAAGAGCTTCAATGCGACTATGGGGATTAATCGTTTGCCATCATACATCTCCTCGATACATCCCTTT...

Protein

Download Protein FASTA

369 aa · TkA01G054470|TK1151|PROTEIN

MIVDCHATPVHVIQDESLMQPLSLVGSTLRAPHGCHAQYMANMGSMSSLAMAVIINGLDDENSGVRASMRLWGLIVCHHTSPRYIPFPLRYACEFLMQAFGLQLNMELQLAAQMSEKRILRTQTLLCDMLLRDSPTGIVTQSPSIMDLVKCDGAALYNQGKYHPLGVTPTESQIKDIVDWLSSCHRDSTGLSTDSLADAGYHGAVSLGDSVCGMAAAYITPNDILFWFRSNTGKEVKWGGAKHHPEDKDDGQRMHPRSSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G054470`
TK1151 ID	TkA01G054470
OH-1004 ID	LXL04_005408
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.200
Protein coverage (%)	TK1151 99.458 / OH-1004 33.004 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G054470`
Location	Chr01:14070696-14074384 (-)
Description	Similar to PHYB: Phytochrome B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005408` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009584 detection of visible light Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0017007 protein-bilin linkage Biological Process GO:0017009 protein-phycocyanobilin linkage Biological Process GO:0017012 protein-phytochromobilin linkage Biological Process GO:0005634 nucleus Cellular Component GO:0000155 phosphorelay sensor kinase activity Molecular Function GO:0009881 photoreceptor activity Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	gmx:100794865 sbi:8081072 sly:101262847 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.414

Rank 1 · TkA01G054470 · TK1151

Nucleus0.250

Rank 2 · TkA01G054470 · TK1151

Cell membrane0.166

Rank 3 · TkA01G054470 · TK1151

Endoplasmic reticulum0.162

Rank 4 · TkA01G054470 · TK1151

Mitochondrion0.147

Rank 5 · TkA01G054470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01590GAF20-108 aa

PF00360PHY121-294 aa

PF00989PAS326-357 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G054470	`PF01590`	GAF	20	108	1.5e-08	36.0
TkA01G054470	`PF00360`	PHY	121	294	1.8e-55	187.8
TkA01G054470	`PF00989`	PAS	326	357	2.9e-06	28.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card