LXL04_005408 | RubberDandelionOmics

Gene overview

LXL04_005408

Reference: OH-1004 Chr: Chr01 Coordinates: 162858486-162862312 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3345 bp · LXL04_005408|LXL04_005408|OH1004|cDNA

ATAAAAATGGCTTCCGGGAGTAGAACAAGCTCAAGGCTTCATCTCCATAGTAACAACCAAGCGTCGTCTTCAGTGAGCAAAGCCACTGCACAATACACAGTCGATGCAAGATTACACGCTGTTTTCGAACAATCCGGCGGCTCCGGTAAGTCCTTCGATTACTCGCAATCACTTAAGACCACCACACAATCATCAAACCCTGAACAGCAAATCAGTGCGTATTTGTCGAGAATTCAAAGAGGTGGTCACATTCAACCCTT...

CDS

Download CDS FASTA

3339 bp · LXL04_005408|LXL04_005408|OH1004|CDS

ATGGCTTCCGGGAGTAGAACAAGCTCAAGGCTTCATCTCCATAGTAACAACCAAGCGTCGTCTTCAGTGAGCAAAGCCACTGCACAATACACAGTCGATGCAAGATTACACGCTGTTTTCGAACAATCCGGCGGCTCCGGTAAGTCCTTCGATTACTCGCAATCACTTAAGACCACCACACAATCATCAAACCCTGAACAGCAAATCAGTGCGTATTTGTCGAGAATTCAAAGAGGTGGTCACATTCAACCCTTCGGTTG...

Protein

Download Protein FASTA

1112 aa · LXL04_005408|LXL04_005408|OH1004|PROTEIN

MASGSRTSSRLHLHSNNQASSSVSKATAQYTVDARLHAVFEQSGGSGKSFDYSQSLKTTTQSSNPEQQISAYLSRIQRGGHIQPFGCMIAIDDSTFKVIAFSENARERLGLAPQSVPSIEKPEILTIGTDVKTLFTPSSSPLLDRAFRAREITLLNPVWVQSKVSGKPFYAIMHRIDVGIVIDLEPARAEDPALSIAGAVQSQKLAVRAISNLQALPGGDIKLLCDAVVRNVRELTGYDRVMVYKFHEDEHGEVVAESKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005408`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_005408`
Location	Chr01:162858486-162862312 (+)
Description	Similar to PHYB: Phytochrome B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005408` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009584 detection of visible light Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0017007 protein-bilin linkage Biological Process GO:0017009 protein-phycocyanobilin linkage Biological Process GO:0017012 protein-phytochromobilin linkage Biological Process GO:0005634 nucleus Cellular Component GO:0000155 phosphorelay sensor kinase activity Molecular Function GO:0009881 photoreceptor activity Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	gmx:100794865 sbi:8081072 sly:101262847 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.455

Rank 1 · LXL04_005408 · OH-1004

Nucleus0.255

Rank 2 · LXL04_005408 · OH-1004

Cell membrane0.173

Rank 3 · LXL04_005408 · OH-1004

Golgi apparatus0.097

Rank 4 · LXL04_005408 · OH-1004

Endoplasmic reticulum0.097

Rank 5 · LXL04_005408 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08446.18PAS_271-187 aa

PF01590.33GAF221-398 aa

PF00360.27PHY411-584 aa

PF00989.32PAS616-731 aa

PF08448.17PAS_4624-734 aa

PF00989.32PAS747-866 aa

PF00512.32HisKA891-944 aa

PF02518.32HATPase_c1000-1108 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005408	`PF08446.18`	PAS_2	71	187	6.7e-36	124.0
LXL04_005408	`PF01590.33`	GAF	221	398	3.8e-17	63.8
LXL04_005408	`PF00360.27`	PHY	411	584	1.3e-54	185.0
LXL04_005408	`PF00989.32`	PAS	616	731	7e-46	155.6
LXL04_005408	`PF08448.17`	PAS_4	624	734	3.3e-11	44.1
LXL04_005408	`PF00989.32`	PAS	747	866	7e-46	155.6
LXL04_005408	`PF00512.32`	HisKA	891	944	4.6e-11	43.3
LXL04_005408	`PF02518.32`	HATPase_c	1000	1108	3e-16	60.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card