TkA01G049060 | RubberDandelionOmics

Gene overview

TkA01G049060

Reference: TK1151 Chr: Chr01 Coordinates: 12682961-12683710 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

750 bp · TkA01G049060|TK1151|cDNA

ATGCAAAATGTTCTTTACACATGGAATAGTCGTCGTAACCAACCCGGGGCACAAATGGGTGGTCCAGGGAACAACGGAGCCACTGGACTCGACCCACATATTATTAAAACTTTCCCTACCTATATTTACTCAGATGTTAAAAAATTTCGGCGTAAGAGATACGGATTAGAATGTGCTATATGTTTATGTGAATTTGAGGACGATAATGTCCTTCGGATTTTAACAAAATGTTACCATGTTTTCCATCAAGATTGTATAGA...

CDS

Download CDS FASTA

750 bp · TkA01G049060|TK1151|CDS

ATGCAAAATGTTCTTTACACATGGAATAGTCGTCGTAACCAACCCGGGGCACAAATGGGTGGTCCAGGGAACAACGGAGCCACTGGACTCGACCCACATATTATTAAAACTTTCCCTACCTATATTTACTCAGATGTTAAAAAATTTCGGCGTAAGAGATACGGATTAGAATGTGCTATATGTTTATGTGAATTTGAGGACGATAATGTCCTTCGGATTTTAACAAAATGTTACCATGTTTTCCATCAAGATTGTATAGA...

Protein

Download Protein FASTA

249 aa · TkA01G049060|TK1151|PROTEIN

MQNVLYTWNSRRNQPGAQMGGPGNNGATGLDPHIIKTFPTYIYSDVKKFRRKRYGLECAICLCEFEDDNVLRILTKCYHVFHQDCIDLWLESHKSCPFCRRGLETPLPSPEKSPISQHSTPMHEIHENELLEDTYTVNIGDENEMNNNTDATEENKTEKHVNIDIDRGEVKRTDKFPRSKSTGHSITKNSKTTEDEDKFTLRLPEHIQAKLIHGHTWTRSCTEFGEFKTRSTGSIGLGEASTSRDVNKP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G049060`
TK1151 ID	TkA01G049060
OH-1004 ID	LXL04_005444
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.189 / OH-1004 30.440 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G049060

Location Chr01:12682961-12683710 (+)

Description Similar to At4g17910: Uncharacterized protein At4g17910

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g46650`	RING-H2 finger protein ATL30.	No verified direct reference in this release
`At4g17920`	RING-H2 finger protein ATL29.	No verified direct reference in this release
`At3g05200`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At2g35000`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At1g35330`	RING-H2 finger protein ATL34.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005444 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006506 GPI anchor biosynthetic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0032216 glucosaminyl-phosphatidylinositol O-acyltransferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT4G17910

ath:AT4G17920

ath:AT5G46650

ddi:DDB_G0286111

ncr:NCU00913

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.545

Rank 1 · TkA01G049060 · TK1151

Nucleus0.332

Rank 2 · TkA01G049060 · TK1151

Cell membrane0.171

Rank 3 · TkA01G049060 · TK1151

Mitochondrion0.080

Rank 4 · TkA01G049060 · TK1151

Lysosome / Vacuole0.061

Rank 5 · TkA01G049060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08746zf-RING-like47-61 aa

PF21872SAM_552-95 aa

PF04641Rtf252-178 aa

PF11789zf-Nse53-99 aa

PF05883Baculo_RING55-101 aa

PF11793FANCL_C56-94 aa

PF13639zf-RING_257-100 aa

PF17123zf-RING_1157-86 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G049060	`PF08746`	zf-RING-like	47	61	5.5	7.9
TkA01G049060	`PF21872`	SAM_5	52	95	0.07	13.6
TkA01G049060	`PF04641`	Rtf2	52	178	1.3	9.0
TkA01G049060	`PF11789`	zf-Nse	53	99	0.1	13.2
TkA01G049060	`PF05883`	Baculo_RING	55	101	0.052	14.2
TkA01G049060	`PF11793`	FANCL_C	56	94	0.45	11.6
TkA01G049060	`PF13639`	zf-RING_2	57	100	6e-14	52.8
TkA01G049060	`PF17123`	zf-RING_11	57	86	7.2e-09	35.9
TkA01G049060	`PF13923`	zf-C3HC4_2	57	99	1.5e-08	35.0
TkA01G049060	`PF14634`	zf-RING_5	57	101	6.8e-06	26.7
TkA01G049060	`PF13920`	zf-C3HC4_3	57	102	0.0035	17.8
TkA01G049060	`PF00097`	zf-C3HC4	58	99	3.9e-07	30.5
TkA01G049060	`PF13445`	zf-RING_UBOX	58	97	1.5e-06	28.8
TkA01G049060	`PF12906`	RINGv	58	99	0.097	13.6
TkA01G049060	`PF14447`	Prok-RING_4	58	104	0.11	13.1
TkA01G049060	`PF12678`	zf-rbx1	61	100	1.1e-09	39.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FIR0`	Arabidopsis thaliana	sp\|Q9FIR0\|ATL30_ARATH RING-H2 finger protein ATL30	44.100%	Swiss-Prot	Medium
`O49691`	Arabidopsis thaliana	sp\|O49691\|ATL29_ARATH RING-H2 finger protein ATL29	41.900%	Swiss-Prot	Medium
`Q8RXX9`	Arabidopsis thaliana	sp\|Q8RXX9\|ATL6_ARATH E3 ubiquitin-protein ligase ATL6	38.900%	Swiss-Prot	Medium
`O64763`	Arabidopsis thaliana	sp\|O64763\|ATL9_ARATH E3 ubiquitin-protein ligase ATL9	37.200%	Swiss-Prot	Medium
`Q9C7I1`	Arabidopsis thaliana	sp\|Q9C7I1\|ATL34_ARATH RING-H2 finger protein ATL34	32.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card