RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G036490
Reference: TK1151 Chr: Chr01 Coordinates: 9446659-9450855 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2244 bp · TkA01G036490|TK1151|cDNA

TACAACACGTTACCAAACGAGGACTCCTTTTCAATCTGATTCATTCATCCAGCTAATTCCCCTTTCTTCAGCCACAAAAATCGCCTCCCTGAAAAACGCCGGATCTGTTTGGTTCTCCAGCTAAACCATTTCCTCTACCACCGCCTCTCTCCTTCGCTCGATCTCTCATCCATCCAGACCGCTCTCACCATGACAACATCCATATCCACCGCTGCCACAAGAACCGCCCAACACTTCATGACCATCGACTACCCACCCCA...

CDS

Download CDS FASTA

1092 bp · TkA01G036490|TK1151|CDS

ATGCACGTAGATCCAGGAATCTCGAAATTAATGAAGCGGAAGGAGCGCAAGAAGAAGGTCAAACCATCGGCGAAGAAGATAAAAAACGTAGCGAGAAGCTTCCGTACGTTCATGCCCGTGCTCGGCGAGGTCAAGCAACAAAGCCGTAGCTTAGCTGAACGAGCAAGAAGAGAGAAGATTAATGCTAGGATGAAACTCCTTCAAGAGCTGGTCCCTGGTTGTAACAAGATTTCAGGTACTGCCATGGTGCTTGATTTGGT...

Protein

Download Protein FASTA

363 aa · TkA01G036490|TK1151|PROTEIN

MHVDPGISKLMKRKERKKKVKPSAKKIKNVARSFRTFMPVLGEVKQQSRSLAERARREKINARMKLLQELVPGCNKISGTAMVLDLVSCFKILSSLSLLQELKQQRQKKDDDMRKDIEAPKSFKKPEKTVTQESTKTVNSEVILPVKEEADINGPKSFKKWGGPFFNSICVMASYISSKWLGETPLIHAARQSHTSTAKYLFEHGANPTLASELGATALHHVAGTGMDFDLSCETHVMSTTLEFARGKVNITVGGATPLY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G036490
TK1151 IDTkA01G036490
OH-1004 IDLXL04_014175
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)61.200
Protein coverage (%)TK1151 50.138 / OH-1004 49.899
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G036490
LocationChr01:9446659-9450855 (+)
DescriptionSimilar to Ank3: Ankyrin-3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g42300 Transcription factor bHLH48. No verified direct reference in this release
At1g59640 Involved in the control of petal size, by interfering with postmitotic cell expansion to limit final petal cell size. No verified direct reference in this release
At1g10120 Transcriptional activator involved in cell elongation.
Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0193800 Transcription factor that forms a ternary complex with RSS3 and TIFY11A/JAZ9 to negatively regulate jasmonate-responsive genes. No verified direct reference in this release
Os03g0802900 Transcription factor that may regulate jasmonate-regulated genes. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014175 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000281 mitotic cytokinesis Biological Process
GO:0007009 plasma membrane organization Biological Process
GO:0007165 signal transduction Biological Process
GO:0007528 neuromuscular junction development Biological Process
GO:0010628 positive regulation of gene expression Biological Process
GO:0010650 positive regulation of cell communication by electrical coupling Biological Process
GO:0010765 positive regulation of sodium ion transport Biological Process
GO:0010960 magnesium ion homeostasis Biological Process
GO:0030951 establishment or maintenance of microtubule cytoskeleton polarity Biological Process
GO:0032507 maintenance of protein location in cell Biological Process
GO:0034112 positive regulation of homotypic cell-cell adhesion Biological Process
GO:0043001 Golgi to plasma membrane protein transport Biological Process
KEGG gene cross-reference
mmu:11735
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.848
Rank 1 · TkA01G036490 · TK1151
Cytoplasm0.213
Rank 2 · TkA01G036490 · TK1151
Mitochondrion0.037
Rank 3 · TkA01G036490 · TK1151
Cell membrane0.028
Rank 4 · TkA01G036490 · TK1151
Endoplasmic reticulum0.014
Rank 5 · TkA01G036490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30696RNF213_stalk19-143 aa
PF00010HLH46-74 aa
PF23173bHLH_SAC5153-85 aa
PF12796Ank_2181-223 aa
PF00023Ank182-210 aa
PF13606Ank_3182-208 aa
PF13857Ank_5182-221 aa
PF13637Ank_4187-230 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G036490PF30696RNF213_stalk191430.02113.6
TkA01G036490PF00010HLH46740.0002421.6
TkA01G036490PF23173bHLH_SAC5153850.002218.6
TkA01G036490PF12796Ank_21812234.2e-1556.8
TkA01G036490PF00023Ank1822104.4e-1349.4
TkA01G036490PF13606Ank_31822084.4e-1039.5
TkA01G036490PF13857Ank_51822215e-0937.1
TkA01G036490PF13637Ank_41872303.7e-1350.0
TkA01G036490PF00023Ank2152234.4e-1349.4
TkA01G036490PF13606Ank_32152244.4e-1039.5
TkA01G036490PF12796Ank_22543084.2e-1556.8
TkA01G036490PF13637Ank_42542753.7e-1350.0
TkA01G036490PF00023Ank2552854.4e-1349.4
TkA01G036490PF13606Ank_32552834.4e-1039.5
TkA01G036490PF13857Ank_52552955e-0937.1
TkA01G036490PF13637Ank_42693073.7e-1350.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8VZ02Arabidopsis thalianasp|Q8VZ02|BH048_ARATH Transcription factor bHLH4863.600%Swiss-ProtLow
Q0JXE7Arabidopsis thalianasp|Q0JXE7|BPE_ARATH Transcription factor BPE76.300%Swiss-ProtLow
Q6NKN9Arabidopsis thalianasp|Q6NKN9|BH074_ARATH Transcription factor bHLH7476.300%Swiss-ProtLow
Q69WS3Oryza sativa subsp. japonicasp|Q69WS3|BH094_ORYSJ Transcription factor BHLH09476.300%Swiss-ProtLow
Q84T08Oryza sativa subsp. japonicasp|Q84T08|BH089_ORYSJ Transcription factor BHLH08976.300%Swiss-ProtLow

JBrowse

View in Genome Browser