TkA01G009330 | RubberDandelionOmics

Gene overview

TkA01G009330

Reference: TK1151 Chr: Chr01 Coordinates: 2531467-2532928 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

852 bp · TkA01G009330|TK1151|cDNA

AAACTTAGTAGGTAACGATTCCAACTGATTTGTGATCTCTATGTACCATATTTGGCACCACCCACTCCTACCTTTTACCAACCAACTGTCTCCTTTTCTCCCATTTCAATCTTTGAAGTTCTTTGAGATTCTTTATCGGTCACAAGAAAGTGCTCAAGTATTGAAGGATGGGGGAGGAAAAACAAGAAACCGAGAAAGATATGGCTTCAGAACCCCATGTAACATCTCCACCACCACCCGAACTCAAATCAAGTTTGGTC...

CDS

Download CDS FASTA

507 bp · TkA01G009330|TK1151|CDS

ATGGGGGAGGAAAAACAAGAAACCGAGAAAGATATGGCTTCAGAACCCCATGTAACATCTCCACCACCACCCGAACTCAAATCAAGTTTGGTCGCAACACCACCACCGGAGAACATAAAACCTCCTCATGGTGAAAATAGTGGACTCGAAATAGTAGTTGCAGAGAAAAGAATGGCGCTAATCAAAGCGTGGGAGGAAAACGAAAAAACAAAGGCGGACAACAAGGCACACACAAAAAAGACCGAAATCGGAGCATGGGA...

Protein

Download Protein FASTA

168 aa · TkA01G009330|TK1151|PROTEIN

MGEEKQETEKDMASEPHVTSPPPPELKSSLVATPPPENIKPPHGENSGLEIVVAEKRMALIKAWEENEKTKADNKAHTKKTEIGAWENTKKAVIEADLKQIEENIEIEKVKQREKMKNKMAAIHKEAQEKRAIVEAKRGEDIIKAKEAAAKFHATGTLPNKLFKCFGY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G009330`
TK1151 ID	TkA01G009330
OH-1004 ID	LXL04_005889
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G009330

Location Chr01:2531467-2532928 (-)

Description Similar to REM1.4: Remorin 1.4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23750`	Remorin 1.4.	No verified direct reference in this release
`At2g45820`	Exhibits a non sequence-specific DNA-binding activity.	No verified direct reference in this release
`At3g61260`	Uncharacterized protein At3g61260.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005889 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007267 cell-cell signaling Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010555 response to mannitol Biological Process

GO:0051607 defense response to virus Biological Process

GO:0051665 membrane raft localization Biological Process

GO:1900458 negative regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G45820

ath:AT3G61260

ath:AT5G23750

dosa:Os07g0569100

sot:102577743

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.590

Rank 1 · TkA01G009330 · TK1151

Cytoplasm0.293

Rank 2 · TkA01G009330 · TK1151

Nucleus0.215

Rank 3 · TkA01G009330 · TK1151

Endoplasmic reticulum0.047

Rank 4 · TkA01G009330 · TK1151

Mitochondrion0.044

Rank 5 · TkA01G009330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28534DUF843051-132 aa

PF20524DUF673954-163 aa

PF03763Remorin_C56-161 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G009330	`PF28534`	DUF8430	51	132	0.075	13.5
TkA01G009330	`PF20524`	DUF6739	54	163	0.72	8.5
TkA01G009330	`PF03763`	Remorin_C	56	161	5e-30	104.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFA5`	Arabidopsis thaliana	sp\|Q9FFA5\|RMR14_ARATH Remorin 1.4	37.600%	Swiss-Prot	Medium
`O80837`	Arabidopsis thaliana	sp\|O80837\|REMO_ARATH Remorin	31.600%	Swiss-Prot	Medium
`Q9M2D8`	Arabidopsis thaliana	sp\|Q9M2D8\|Y3126_ARATH Uncharacterized protein At3g61260	32.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card