TkA01G004330 | RubberDandelionOmics

Gene overview

TkA01G004330

Reference: TK1151 Chr: Chr01 Coordinates: 1140693-1143564 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

833 bp · TkA01G004330|TK1151|cDNA

CGATAATATAAGTTGATCCTTTTTGGCAAACACGAGTTAATCCTTTTTCTTACAGATAATGATCTGTCAATGTCCGTTACAGACGCGCTGACGCGCTCCATAACCAAACGAAAACTCACCAAATCCGGTTTCTGTGTATCCACTACTCTTTTGACATCCCTTCCACACCCAACCCCAAACCATCTTCCCCTTTCTATAATTGGCTTCACCAGCAATCTCCCCCACTCTCTTATGAATCTGGATTGTGGCTTGAGAACCAG...

CDS

Download CDS FASTA

609 bp · TkA01G004330|TK1151|CDS

ATGTCCGTTACAGACGCGCTGACGCGCTCCATAACCAAACGAAAACTCACCAAATCCGGTTTCTGTGTATCCACTACTCTTTTGACATCCCTTCCACACCCAACCCCAAACCATCTTCCCCTTTCTATAATTGGCTTCACCAGCAATCTCCCCCACTCTCTTATGAATCTGGATTGTGGCTTGAGAACCAGATCCTGCCGTGTCATTCAAGACACTTCCATGGCTGTTGCTGCTTTACAACTCGAAGACGACGCTGAAGA...

Protein

Download Protein FASTA

202 aa · TkA01G004330|TK1151|PROTEIN

MSVTDALTRSITKRKLTKSGFCVSTTLLTSLPHPTPNHLPLSIIGFTSNLPHSLMNLDCGLRTRSCRVIQDTSMAVAALQLEDDAEEIDDGLKQSCWANMPQELLREVLIRIESSENKWPSRKNVVGCATVCRSWREIMKEIVKRPEISGLLTFPISVKQHLLMMENFFLLLASLDVPHVPITSSHCMVMTCQRGAIDILEN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G004330`
TK1151 ID	TkA01G004330
OH-1004 ID	LXL04_005963
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 79.208 / OH-1004 35.955 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G004330

Location Chr01:1140693-1143564 (+)

Description Similar to TULP6: Tubby-like F-box protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47900`	Involved in abiotic stress signaling.	The subcellular localization of Tubby-like proteins and participation in stress signaling and root colonization by the mutualist Piriformospora indica.2012 · DOI: 10.1104/pp.112.201319

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0351400`	Tubby-like F-box protein 6.	No verified direct reference in this release
`Os12g0163400`	Tubby-like F-box protein 14.	No verified direct reference in this release
`Os11g0163600`	Tubby-like F-box protein 13.	No verified direct reference in this release
`Os07g0667000`	Tubby-like F-box protein 11.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005963 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009620 response to fungus Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0071470 cellular response to osmotic stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G47900

ath:AT3G06380

ath:AT5G18680

dosa:Os03g0351400

dosa:Os07g0667000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.650

Rank 1 · TkA01G004330 · TK1151

Cytoplasm0.284

Rank 2 · TkA01G004330 · TK1151

Cell membrane0.087

Rank 3 · TkA01G004330 · TK1151

Endoplasmic reticulum0.072

Rank 4 · TkA01G004330 · TK1151

Plastid0.057

Rank 5 · TkA01G004330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like97-139 aa

PF00646F-box97-140 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G004330	`PF12937`	F-box-like	97	139	0.00053	20.4
TkA01G004330	`PF00646`	F-box	97	140	0.00072	20.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY21`	Arabidopsis thaliana	sp\|Q8VY21\|TLP3_ARATH Tubby-like F-box protein 3	62.600%	Swiss-Prot	Medium
`Q10LG8`	Oryza sativa subsp. japonica	sp\|Q10LG8\|TLP6_ORYSJ Tubby-like F-box protein 6	71.000%	Swiss-Prot	Low
`Q2QXB2`	Oryza sativa subsp. japonica	sp\|Q2QXB2\|TLP14_ORYSJ Tubby-like F-box protein 14	62.000%	Swiss-Prot	Low
`Q53PP5`	Oryza sativa subsp. japonica	sp\|Q53PP5\|TLP13_ORYSJ Tubby-like F-box protein 13	60.900%	Swiss-Prot	Low
`Q8H485`	Oryza sativa subsp. japonica	sp\|Q8H485\|TLP11_ORYSJ Tubby-like F-box protein 11	63.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card