LXL04_005963 | RubberDandelionOmics

Gene overview

LXL04_005963

Reference: OH-1004 Chr: Chr01 Coordinates: 176389482-176393752 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1338 bp · LXL04_005963|LXL04_005963|OH1004|cDNA

ATGTCCGTTACAGACGCGCTGACGCGCTCCATAACCAAACGAAAACTCACCAAATCCGGTTTCTGTGTATCCACTACTCTTTTGACATCCCTTCCACACCCAACGCCAAACCATCTTCCCCTTTCTATAATTGGCTTCACCAGCAATCTCCCCCACTCTCTTATGAATCTGGATTGTGGCTTGAGAACCAGATCCTGCCGTGTCATTCAAGACACTTCCATGGCTGTTGCTGCTTTACAACTCGAAGACGACGCTGAAGA...

CDS

Download CDS FASTA

1338 bp · LXL04_005963|LXL04_005963|OH1004|CDS

ATGTCCGTTACAGACGCGCTGACGCGCTCCATAACCAAACGAAAACTCACCAAATCCGGTTTCTGTGTATCCACTACTCTTTTGACATCCCTTCCACACCCAACGCCAAACCATCTTCCCCTTTCTATAATTGGCTTCACCAGCAATCTCCCCCACTCTCTTATGAATCTGGATTGTGGCTTGAGAACCAGATCCTGCCGTGTCATTCAAGACACTTCCATGGCTGTTGCTGCTTTACAACTCGAAGACGACGCTGAAGA...

Protein

Download Protein FASTA

445 aa · LXL04_005963|LXL04_005963|OH1004|PROTEIN

MSVTDALTRSITKRKLTKSGFCVSTTLLTSLPHPTPNHLPLSIIGFTSNLPHSLMNLDCGLRTRSCRVIQDTSMAVAALQLEDDAEEIDDGLKQSCWANMPQELLREVLIRIESSENKWPSRKNVVGCATVCRSWREIMKEIVKRPEISGLLTFPISVKQPGPRESLLQCFIKRKRSTQTYFLYLSLTQALADDGKFLLAARKFRRTTCTDYIISLHGDDMSKGSNRYIGKLRSNFLGTKFIVYDGLPPHDGAKMMKSRS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005963`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005963

Location Chr01:176389482-176393752 (-)

Description Similar to TULP6: Tubby-like F-box protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47900`	Involved in abiotic stress signaling.	The subcellular localization of Tubby-like proteins and participation in stress signaling and root colonization by the mutualist Piriformospora indica.2012 · DOI: 10.1104/pp.112.201319
`At5g18680`	Tubby-like F-box protein 11.	No verified direct reference in this release
`At3g06380`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	Molecular analyses of the Arabidopsis TUBBY-like protein gene family.2004 · DOI: 10.1104/pp.103.037820

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0351400`	Tubby-like F-box protein 6.	No verified direct reference in this release
`Os07g0667000`	Tubby-like F-box protein 11.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005963 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009620 response to fungus Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0071470 cellular response to osmotic stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G47900

ath:AT3G06380

ath:AT5G18680

dosa:Os03g0351400

dosa:Os07g0667000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.417

Rank 1 · LXL04_005963 · OH-1004

Nucleus0.364

Rank 2 · LXL04_005963 · OH-1004

Cell membrane0.274

Rank 3 · LXL04_005963 · OH-1004

Plastid0.078

Rank 4 · LXL04_005963 · OH-1004

Endoplasmic reticulum0.065

Rank 5 · LXL04_005963 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01167.25Tub158-440 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005963	`PF01167.25`	Tub	158	440	2.9e-105	352.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY21`	Arabidopsis thaliana	Tubby-like F-box protein 3	66.667%	Swiss-Prot	strong database homology
`Q6NPQ1`	Arabidopsis thaliana	Tubby-like F-box protein 11	59.453%	Swiss-Prot	strong database homology
`Q9SQU1`	Arabidopsis thaliana	Tubby-like F-box protein 9	63.025%	Swiss-Prot	strong database homology
`Q10LG8`	Oryza sativa subsp. japonica	Tubby-like F-box protein 6	72.269%	Swiss-Prot	strong database homology
`Q8H485`	Oryza sativa subsp. japonica	Tubby-like F-box protein 11	64.010%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card