LXL04_039144 | RubberDandelionOmics

Gene overview

LXL04_039144

Reference: OH-1004 Chr: Chr09 Coordinates: 60713329-60721667 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3270 bp · LXL04_039144|LXL04_039144|OH1004|cDNA

ATGTTGTCGCTAAAACCTTTTGCGACAGATGTTgcctctgatgtcggactcggtccgagtccgtggtctggTCCGAGGCGTTTGATAGGAGATGTCGGACTcagaccgagtccgtggtctgagtccgagtccgaCTCAGTCCTCTCTCAGATGGAGGACGCATTTGTCAGATCTGTTCCTGAGGTCCTGGATTTTTTTGGAGTAAATCCCACTAAAGGTCTCACTGATATCCAGGTGACCAGCCATGCTCGGATTTATGG...

CDS

Download CDS FASTA

3270 bp · LXL04_039144|LXL04_039144|OH1004|CDS

ATGTTGTCGCTAAAACCTTTTGCGACAGATGTTGCCTCTGATGTCGGACTCGGTCCGAGTCCGTGGTCTGGTCCGAGGCGTTTGATAGGAGATGTCGGACTCAGACCGAGTCCGTGGTCTGAGTCCGAGTCCGACTCAGTCCTCTCTCAGATGGAGGACGCATTTGTCAGATCTGTTCCTGAGGTCCTGGATTTTTTTGGAGTAAATCCCACTAAAGGTCTCACTGATATCCAGGTGACCAGCCATGCTCGGATTTATGG...

Protein

Download Protein FASTA

1089 aa · LXL04_039144|LXL04_039144|OH1004|PROTEIN

MLSLKPFATDVASDVGLGPSPWSGPRRLIGDVGLRPSPWSESESDSVLSQMEDAFVRSVPEVLDFFGVNPTKGLTDIQVTSHARIYGSNVLPQEESTPFWKLVLKQFDDLLVKILIAAAVVSFLLALVNGETGLTAFLEPSVILMILAANAAVGVITETNAEKALEELRAYQADVATVMRNGCFSILPATELVPGDIVEVSVGCKIPADLRMIELLSDQLRVDQAILTGESSSVEKELEALVTTNAVYQDKTNILFSGTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039144`
TK1151 ID	TkA04G508620
OH-1004 ID	LXL04_039144
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.200
Protein coverage (%)	TK1151 97.021 / OH-1004 41.230 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039144

Location Chr09:60713329-60721667 (+)

Description Similar to ECA3: Calcium-transporting ATPase 3, endoplasmic reticulum-type

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10130`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to an endomembrane compartment (Probable).	ECA3, a Golgi-localized P2A-type ATPase, plays a crucial role in manganese nutrition in Arabidopsis.2008 · DOI: 10.1104/pp.107.110817 A distinct endosomal Ca2+/Mn2+ pump affects root growth through the secretory process.2008 · DOI: 10.1104/pp.108.119909

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039144 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006874 intracellular calcium ion homeostasis Biological Process

GO:0006942 regulation of striated muscle contraction Biological Process

GO:0045988 negative regulation of striated muscle contraction Biological Process

GO:0048364 root development Biological Process

GO:0055071 manganese ion homeostasis Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:1903515 calcium ion transport from cytosol to endoplasmic reticulum Biological Process

GO:1990036 calcium ion import into sarcoplasmic reticulum Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

KEGG gene cross-reference

aga:1276852

ath:AT1G10130

gga:395707

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.263

Rank 1 · LXL04_039144 · OH-1004

Cell membrane0.252

Rank 2 · LXL04_039144 · OH-1004

Lysosome / Vacuole0.197

Rank 3 · LXL04_039144 · OH-1004

Golgi apparatus0.185

Rank 4 · LXL04_039144 · OH-1004

Cytoplasm0.137

Rank 5 · LXL04_039144 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00690.32Cation_ATPase_N58-122 aa

PF00122.26E1-E2_ATPase172-286 aa

PF13246.13Cation_ATPase459-646 aa

PF00702.33Hydrolase632-755 aa

PF08282.19Hydrolase_3726-782 aa

PF00689.27Cation_ATPase_C826-1024 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039144	`PF00690.32`	Cation_ATPase_N	58	122	6.9e-18	64.8
LXL04_039144	`PF00122.26`	E1-E2_ATPase	172	286	6.5e-24	84.4
LXL04_039144	`PF13246.13`	Cation_ATPase	459	646	5.5e-41	141.1
LXL04_039144	`PF00702.33`	Hydrolase	632	755	2e-15	58.4
LXL04_039144	`PF08282.19`	Hydrolase_3	726	782	1.5e-07	32.1
LXL04_039144	`PF00689.27`	Cation_ATPase_C	826	1024	5.8e-45	153.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SY55`	Arabidopsis thaliana	Calcium-transporting ATPase 3, endoplasmic reticulum-type	79.981%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card