LXL04_039106 | RubberDandelionOmics

Gene overview

LXL04_039106

Reference: OH-1004 Chr: Chr09 Coordinates: 59349556-59352873 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1599 bp · LXL04_039106|LXL04_039106|OH1004|cDNA

ATGAGGCTGCACTGTTGTTTTGGTGGAACGACGATTCAAACCATGAAACTCGCGTCAATTCCATACAGGACGTGTGCAACATCGCCGTCTCTGCGATCCTCCGCCGCCATTTCAAGACCATTCGCTCTCTTTAAAACCCTATCCGCATCTCACTCACCCAACTGGCCACACCGGTTTCCGTTCCACATCAGAGCATTATCCTCAGCGGCGGCTTCTGCACAACCAGCTGTTGATTCCACTAACACTGTTTCGGTCGATTA...

CDS

Download CDS FASTA

1599 bp · LXL04_039106|LXL04_039106|OH1004|CDS

ATGAGGCTGCACTGTTGTTTTGGTGGAACGACGATTCAAACCATGAAACTCGCGTCAATTCCATACAGGACGTGTGCAACATCGCCGTCTCTGCGATCCTCCGCCGCCATTTCAAGACCATTCGCTCTCTTTAAAACCCTATCCGCATCTCACTCACCCAACTGGCCACACCGGTTTCCGTTCCACATCAGAGCATTATCCTCAGCGGCGGCTTCTGCACAACCAGCTGTTGATTCCACTAACACTGTTTCGGTCGATTA...

Protein

Download Protein FASTA

532 aa · LXL04_039106|LXL04_039106|OH1004|PROTEIN

MRLHCCFGGTTIQTMKLASIPYRTCATSPSLRSSAAISRPFALFKTLSASHSPNWPHRFPFHIRALSSAAASAQPAVDSTNTVSVDYSVVKPQWKAAIDFKSILENKSAVAANLKNRNSNANLELVIELYEKLLQLQKEVEELRYERNTVANKMKGKVEPLERQTLIEQGKNLKDQLVTLEEDLIKLTDSLQREAQCIPNMAHPDVPIGGEDSSTIRKTVGSPREFTFPIKDHVQLGKELDLFDFDAAAEVSGSKFYYLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039106`
TK1151 ID	TkA04G504550
OH-1004 ID	LXL04_039106
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039106

Location Chr09:59349556-59352873 (-)

Description Similar to OVA7: Serine--tRNA ligase, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11870`	Catalyzes the attachment of serine to tRNA(Ser).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039106 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006434 seryl-tRNA aminoacylation Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0016260 L-selenocysteine biosynthetic process Biological Process

GO:0048481 plant ovule development Biological Process

GO:0070158 mitochondrial seryl-tRNA aminoacylation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0004828 serine-tRNA ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G11870

baf:BAPKO_0234

bafz:BafPKo_0228

bga:BG0229

rxy:Rxyl_1086

tde:TDE_2307

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.765

Rank 1 · LXL04_039106 · OH-1004

Plastid0.216

Rank 2 · LXL04_039106 · OH-1004

Cytoplasm0.084

Rank 3 · LXL04_039106 · OH-1004

Nucleus0.047

Rank 4 · LXL04_039106 · OH-1004

Peroxisome0.012

Rank 5 · LXL04_039106 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02403.28Seryl_tRNA_N98-201 aa

PF00587.31tRNA-synt_2b317-504 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039106	`PF02403.28`	Seryl_tRNA_N	98	201	5.1e-18	66.0
LXL04_039106	`PF00587.31`	tRNA-synt_2b	317	504	5.4e-33	115.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWT8`	Arabidopsis thaliana	Serine--tRNA ligase, chloroplastic/mitochondrial	71.233%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card