TkA04G504550 | RubberDandelionOmics

Gene overview

TkA04G504550

Reference: TK1151 Chr: Chr04 Coordinates: 127446295-127449978 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1878 bp · TkA04G504550|TK1151|cDNA

AAGAACTATCCTGCGTCTCTGAGTTGCATCTTCTTCACGACGCACTCACACCAGAAGCAGAGATGAGGCTGCACTGTTGTTTTGGTGGAACGACGATTCAAACCATGAAACTCGCGTCAATTCCATACAGGACGTGTGCAACATCGCCGTCTCTGCGATCCTCCGCCGCCATTTCAAGACGATTCGCTCTCTTTAAAACCCTATCCGCATCTCACTCACGCAACTGGCCACACCGGTTTCCATTCCACATCAGAGCATTA...

CDS

Download CDS FASTA

1599 bp · TkA04G504550|TK1151|CDS

ATGAGGCTGCACTGTTGTTTTGGTGGAACGACGATTCAAACCATGAAACTCGCGTCAATTCCATACAGGACGTGTGCAACATCGCCGTCTCTGCGATCCTCCGCCGCCATTTCAAGACGATTCGCTCTCTTTAAAACCCTATCCGCATCTCACTCACGCAACTGGCCACACCGGTTTCCATTCCACATCAGAGCATTATCCTCAGCGGCGGCTTCAGCACAACCAGCTGTTGATACCACTAACACTGTTTCGGTCGATTA...

Protein

Download Protein FASTA

532 aa · TkA04G504550|TK1151|PROTEIN

MRLHCCFGGTTIQTMKLASIPYRTCATSPSLRSSAAISRRFALFKTLSASHSRNWPHRFPFHIRALSSAAASAQPAVDTTNTVSVDYSVVKPQWKAAIDFKSILENKSAVAANLKNRNSNANLELVIELYEKLLQLQKEVEELRYERNTVANKMKGKVEPLERQTLIEQGKNLKDQLVTLEEDLIKLTDSLQREAQCIPNMAHPDVPIGGEDSSTIRKTVGSPREFTFPIKDHVQLGKELDLFDFDAAAEVSGSKFYYLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G504550`
TK1151 ID	TkA04G504550
OH-1004 ID	LXL04_039106
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G504550

Location Chr04:127446295-127449978 (-)

Description Similar to OVA7: Serine--tRNA ligase, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11870`	Catalyzes the attachment of serine to tRNA(Ser).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039106 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006434 seryl-tRNA aminoacylation Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0016260 L-selenocysteine biosynthetic process Biological Process

GO:0048481 plant ovule development Biological Process

GO:0070158 mitochondrial seryl-tRNA aminoacylation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0004828 serine-tRNA ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G11870

baf:BAPKO_0234

bafz:BafPKo_0228

bga:BG0229

rxy:Rxyl_1086

tde:TDE_2307

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.851

Rank 1 · TkA04G504550 · TK1151

Cytoplasm0.099

Rank 2 · TkA04G504550 · TK1151

Plastid0.084

Rank 3 · TkA04G504550 · TK1151

Nucleus0.053

Rank 4 · TkA04G504550 · TK1151

Cell membrane0.014

Rank 5 · TkA04G504550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02403Seryl_tRNA_N98-201 aa

PF04912Dynamitin125-184 aa

PF00769ERM_C127-149 aa

PF31021RBSN_mid127-187 aa

PF00769ERM_C162-190 aa

PF28520PRR11_2nd172-192 aa

PF00587tRNA-synt_2b317-504 aa

PF28520PRR11_2nd388-395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G504550	`PF02403`	Seryl_tRNA_N	98	201	5.1e-18	66.0
TkA04G504550	`PF04912`	Dynamitin	125	184	0.0083	16.2
TkA04G504550	`PF00769`	ERM_C	127	149	0.28	12.3
TkA04G504550	`PF31021`	RBSN_mid	127	187	0.45	11.9
TkA04G504550	`PF00769`	ERM_C	162	190	0.28	12.3
TkA04G504550	`PF28520`	PRR11_2nd	172	192	0.19	12.3
TkA04G504550	`PF00587`	tRNA-synt_2b	317	504	5.4e-33	115.3
TkA04G504550	`PF28520`	PRR11_2nd	388	395	0.19	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWT8`	Arabidopsis thaliana	sp\|Q8RWT8\|SYSM_ARATH Serine--tRNA ligase, chloroplastic/mitochondrial	72.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card