LXL04_039071 | RubberDandelionOmics

Gene overview

LXL04_039071

Reference: OH-1004 Chr: Chr09 Coordinates: 58489541-58495204 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3777 bp · LXL04_039071|LXL04_039071|OH1004|cDNA

ATGGCAAATTCATCTATACCTGGTATCCTGGAGAAGGTAAGAAGCTATgcattttcttcttcttcttcttcttcttcttcttcttcttcttcttcttgttttgCGTTATATAAAATGTCATATATTGCACAAATTGTTGATGTTTGGTTTATGCAGATGACTGGGAAGGATAAAGATTACAGATACATGGCAACTTCGGACCTATTAAACGAATTAAACAAAGAGGGGTTTAAACTTGATACCGACCTTGAGTTAAGATT...

CDS

Download CDS FASTA

3777 bp · LXL04_039071|LXL04_039071|OH1004|CDS

ATGGCAAATTCATCTATACCTGGTATCCTGGAGAAGGTAAGAAGCTATGCATTTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTTTTGCGTTATATAAAATGTCATATATTGCACAAATTGTTGATGTTTGGTTTATGCAGATGACTGGGAAGGATAAAGATTACAGATACATGGCAACTTCGGACCTATTAAACGAATTAAACAAAGAGGGGTTTAAACTTGATACCGACCTTGAGTTAAGATT...

Protein

Download Protein FASTA

1258 aa · LXL04_039071|LXL04_039071|OH1004|PROTEIN

MANSSIPGILEKVRSYAFSSSSSSSSSSSSSSCFALYKMSYIAQIVDVWFMQMTGKDKDYRYMATSDLLNELNKEGFKLDTDLELRLSNIVLQQLDDAAGDVSGLAVKCLAPLVKKIQEAQVLEMTHKLCDKLLNGKDQHRDIASIALKTIFSEVPTSSVAQSVLVSVSPKLIGGITNPAMKTDIKCECLDILCDILHKFGNLMTSDHEMLLGALLPQLSSNQASVRKKTVSCIASLASSLSDDLLAKATVEVVRLLKNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039071`
TK1151 ID	TkA04G501260
OH-1004 ID	LXL04_039071
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 99.919 / OH-1004 97.456 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039071

Location Chr09:58489541-58495204 (-)

Description Similar to CAND1: Cullin-associated NEDD8-dissociated protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02560`	Key assembly factor of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complexes that promotes the exchange of the substrate-recognition F-box subunit in SCF complexes, thereby playing a key role in the cellular repertoire of SCF complexes.	AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis.2004 · DOI: 10.1104/pp.104.044495 Arabidopsis CAND1, an unmodified CUL1-interacting protein, is involved in multiple developmental pathways controlled by ubiquitin/proteasome-mediated protein Degradation.2004 · DOI: 10.1105/tpc.021949 Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase.2004 · DOI: 10.1105/tpc.021923 The HVE/CAND1 gene is required for the early patterning of leaf venation in Arabidopsis.2006 · DOI: 10.1242/dev.02554 Genetic analysis of CAND1-CUL1 interactions in Arabidopsis supports a role for CAND1-mediated cycling of the SCFTIR1 complex.2008 · DOI: 10.1073/pnas.0804144105

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039071 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010265 SCF complex assembly Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030154 cell differentiation Biological Process

GO:0043086 negative regulation of catalytic activity Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045899 positive regulation of RNA polymerase II transcription preinitiation complex assembly Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT2G02560

hsa:55832

mmu:71902

pon:100173509

rno:117152

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.531

Rank 1 · LXL04_039071 · OH-1004

Nucleus0.472

Rank 2 · LXL04_039071 · OH-1004

Golgi apparatus0.099

Rank 3 · LXL04_039071 · OH-1004

Lysosome / Vacuole0.071

Rank 4 · LXL04_039071 · OH-1004

Cell membrane0.063

Rank 5 · LXL04_039071 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28359.1CandA_N171-299 aa

PF25782.3TPR_CAND1500-625 aa

PF08623.17TIP1201079-1241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039071	`PF28359.1`	CandA_N	171	299	1.4e-23	84.2
LXL04_039071	`PF25782.3`	TPR_CAND1	500	625	4.4e-49	166.8
LXL04_039071	`PF08623.17`	TIP120	1079	1241	3.1e-57	193.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L5Y6`	Arabidopsis thaliana	Cullin-associated NEDD8-dissociated protein 1	79.653%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card