LXL04_037510 | RubberDandelionOmics

Gene overview

LXL04_037510

Reference: OH-1004 Chr: Chr09 Coordinates: 12456676-12459564 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2889 bp · LXL04_037510|LXL04_037510|OH1004|cDNA

ATGGAAGCTCTTGGTTCTTCTCTAATCGATGGCGCCAAATCAATCTTCAAATTAACCTTTTCCGGAATTAGGACCTTTTCCAAATACGAAGAAAACATCTCTGAACTTCGGGAACAAACTTCCTACCTCAAGGAGAAAAAGAAGTTAATCGAAGAAGAAGTATCGATAGCCATACTAGCAGAAAAAACACCAAAACCGCAAGTAATCGAATGGTTAAGAAAAGTTTCTCTATTTGAAGACGGTGTAAGGCCACTCTTACA...

CDS

Download CDS FASTA

2889 bp · LXL04_037510|LXL04_037510|OH1004|CDS

ATGGAAGCTCTTGGTTCTTCTCTAATCGATGGCGCCAAATCAATCTTCAAATTAACCTTTTCCGGAATTAGGACCTTTTCCAAATACGAAGAAAACATCTCTGAACTTCGGGAACAAACTTCCTACCTCAAGGAGAAAAAGAAGTTAATCGAAGAAGAAGTATCGATAGCCATACTAGCAGAAAAAACACCAAAACCGCAAGTAATCGAATGGTTAAGAAAAGTTTCTCTATTTGAAGACGGTGTAAGGCCACTCTTACA...

Protein

Download Protein FASTA

962 aa · LXL04_037510|LXL04_037510|OH1004|PROTEIN

MEALGSSLIDGAKSIFKLTFSGIRTFSKYEENISELREQTSYLKEKKKLIEEEVSIAILAEKTPKPQVIEWLRKVSLFEDGVRPLLHIPNDVKGSKMLYQYQQSWKVVKKLEHVKELNSTYFENVAHERCTPIKAIEEMRVPDLVGTRAASDMRKLLEILIGDDVGRTAVWGKGGIGKTTLVKNLVNHLCKSSPSCFNLVIWVQVTRNLDLNAIQIQIAKRIHVKVEAEDTTHILGNKILRRLKTRLDANRCGKILLILD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037510`
TK1151 ID	TkA04G314630
OH-1004 ID	LXL04_037510
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 84.200 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037510

Location Chr09:12456676-12459564 (+)

Description Similar to At4g27190: Disease resistance protein At4g27190

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27190`	Disease resistance protein.	No verified direct reference in this release
`At4g27220`	Probable disease resistance protein.	No verified direct reference in this release
`At4g26090`	Disease resistance (R) protein that specifically recognizes the AvrRpt2 type III effector avirulence protein from Pseudomonas syringae.	No verified direct reference in this release
`At1g12220`	Disease resistance (R) protein that specifically recognizes the avrPphB type III effector avirulence protein from Pseudomonas syringae.	No verified direct reference in this release
`At1g12280`	Disease resistance protein that mediates defense responses against the bacterial pathogen Pseudomonas syringae pv tomato strain DC3000, and the virulent oomycete Hyaloperonospora arabidopsidis isolate Noco2.	The MEKK1-MKK1/MKK2-MPK4 kinase cascade negatively regulates immunity mediated by a mitogen-activated protein kinase kinase kinase in Arabidopsis.2012 · DOI: 10.1105/tpc.112.097253

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037510 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002220 innate immune response activating cell surface receptor signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0012501 programmed cell death Biological Process

GO:0016045 detection of bacterium Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0098542 defense response to other organism Biological Process

GO:2000377 regulation of reactive oxygen species metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G12220

ath:AT1G12280

ath:AT4G26090

ath:AT4G27190

ath:AT4G27220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.508

Rank 1 · LXL04_037510 · OH-1004

Cytoplasm0.298

Rank 2 · LXL04_037510 · OH-1004

Nucleus0.233

Rank 3 · LXL04_037510 · OH-1004

Endoplasmic reticulum0.081

Rank 4 · LXL04_037510 · OH-1004

Lysosome / Vacuole0.039

Rank 5 · LXL04_037510 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00931.29NB-ARC152-316 aa

PF13401.13AAA_22168-262 aa

PF23559.2WHD_DRP406-473 aa

PF23598.2LRR_14511-701 aa

PF13855.13LRR_8521-578 aa

PF12799.14LRR_4522-562 aa

PF23247.2LRR_RPS2757-852 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037510	`PF00931.29`	NB-ARC	152	316	2.3e-30	106.1
LXL04_037510	`PF13401.13`	AAA_22	168	262	4.7e-06	27.7
LXL04_037510	`PF23559.2`	WHD_DRP	406	473	1.2e-08	35.6
LXL04_037510	`PF23598.2`	LRR_14	511	701	4.4e-10	39.6
LXL04_037510	`PF13855.13`	LRR_8	521	578	8.9e-14	51.7
LXL04_037510	`PF12799.14`	LRR_4	522	562	2.1e-11	44.4
LXL04_037510	`PF23247.2`	LRR_RPS2	757	852	2.2e-13	51.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9T048`	Arabidopsis thaliana	Disease resistance protein At4g27190	34.615%	Swiss-Prot	moderate database homology
`O81825`	Arabidopsis thaliana	Probable disease resistance protein At4g27220	34.011%	Swiss-Prot	moderate database homology
`Q42484`	Arabidopsis thaliana	Disease resistance protein RPS2	27.804%	Swiss-Prot	weak database homology
`O64973`	Arabidopsis thaliana	Disease resistance protein RPS5	28.658%	Swiss-Prot	weak database homology
`P60838`	Arabidopsis thaliana	Disease resistance protein SUMM2	28.555%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card