Gene Card
Gene overview
cDNA / CDS / Protein Sequences
906 bp · LXL04_037182|LXL04_037182|OH1004|cDNA
ATGGTTGCCCCTATTTTTTTCGAATTTACGGGAAATAATGGATATGTCGTGGAAGTATTGGAGTTCGCAGAACGGAATGGGAGTCCGAACTCCGATCTTTACAAGAGAAACAAAGCCCTAATTGCTGAACTGAGTGTACCACGTCCTGGAACAAATGATCTCTTTTTCCCTAACACAGTATTCGCAGCCCTTCTTTGTTCAATTCATGGCTTGTCGACGCGAAGGGATTTGGTAAACGCAATGGGATCAATGTACGCCGC...
906 bp · LXL04_037182|LXL04_037182|OH1004|CDS
ATGGTTGCCCCTATTTTTTTCGAATTTACGGGAAATAATGGATATGTCGTGGAAGTATTGGAGTTCGCAGAACGGAATGGGAGTCCGAACTCCGATCTTTACAAGAGAAACAAAGCCCTAATTGCTGAACTGAGTGTACCACGTCCTGGAACAAATGATCTCTTTTTCCCTAACACAGTATTCGCAGCCCTTCTTTGTTCAATTCATGGCTTGTCGACGCGAAGGGATTTGGTAAACGCAATGGGATCAATGTACGCCGC...
Protein
Download Protein FASTA301 aa · LXL04_037182|LXL04_037182|OH1004|PROTEIN
MVAPIFFEFTGNNGYVVEVLEFAERNGSPNSDLYKRNKALIAELSVPRPGTNDLFFPNTVFAALLCSIHGLSTRRDLVNAMGSMYAATLFLGVQNALAVQPVVDVERTVFYRERAAGIYSALPYAFAQVLVEIPYVFSQSGVYSLVVYAMIGFEWTAAKFFWYFFFEFCCLLYMTYYGMMTVAITPNANIAAIIASSFFALFNLFSGFIIPRPRIPVWWRWSFMERKNSNDMNRLFRVGVPENASYVEGENAVLPLRTPR...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_037182 |
|---|---|
| TK1151 ID | TkA04G255780 |
| OH-1004 ID | LXL04_037182 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 52.492Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_037182 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr09:1131825-1137098 (+) | ||||||||||||
| Description | Similar to PDR1: Pleiotropic drug resistance protein 1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0002229 defense response to oomycetes Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0009414 response to water deprivation Biological Process GO:0009723 response to ethylene Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0009751 response to salicylic acid Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0009914 hormone transport Biological Process GO:0010193 response to ozone Biological Process GO:0010496 intercellular transport Biological Process | ||||||||||||
| KEGG gene cross-reference | ath:AT1G15520 nta:107799533 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01061.30ABC2_membrane69-221 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_037182 | PF01061.30 | ABC2_membrane | 69 | 221 | 6.5e-43 | 147.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.